Log in

View Full Version : Coronavirus



Pages : 1 2 3 [4] 5 6 7 8 9 10 11 12 13 14 15 16 17

monty
13th December 2020, 09:51 AM
Registered nurse with 20 years experiensce tells you the truth about testing

https://lbry.tv/@thesearethedamned:1/RN_BSN_Nurse_with_over_20_years_experience_tells_y ou_the_truth_about_x264_001:2

Amanda
13th December 2020, 03:17 PM
Registered nurse with 20 years experiensce tells you the truth about testing

https://lbry.tv/@thesearethedamned:1/RN_BSN_Nurse_with_over_20_years_experience_tells_y ou_the_truth_about_x264_001:2


Good for her!! I love how she calls out the other side stupid and moronic for falling for this crap! (sometimes you just need to call a spade a spade)

LOL on this one "covid 19 is the name of their hoax and their plot and their plan, not the name of any illness"

She did a great job! I love how she also brought up "personal responsibility" to keep yourself well, not everyone else's responsibility.

I also like how she brought up people who need attention are going out and getting tested even though they still feel fine, just so they can say "I tested positive for Covid 19" and get attention. That's something I've been thinking about too (like with the holohoax, once they got that hoax narrative going, then they all starting coming out of the woodwork with their make-believe stories so they could get attention, sympathy and $$$ for their BS story)--there are certain types of people who just like to create drama around themselves so they can get attention. I could see these people easily feeding into the narrative. A friend of mine had someone fixing something at her house, and this guy was barely getting the job done because he was too busy telling her his covid 19 story (which sounded like an over-dramatized case of the flu).

I like this woman's approach--I think it might break through some of the brainwashing. It almost seems like the calm rational tone with certain people doesn't work. I've actually had more success waking up family members by taking a rougher approach like this (maybe it's better at breaking through the hypnotic spell they are under).

The other key thing I bring up is the death count and how it's no different from previous years, so where's the pandemic? And on info I send out, I add this from Dr. Michael Yeadon (seems to have more weight coming from him as an ex-Chief Scientist from Pfizer):


From his twitter: "Look, I can’t be more direct. We can’t have a lethal pandemic sweeping the land, killing thousands of people & it NOT show up in the total mortality charts…It’s MISDIAGNOSES. Please wake up. It’s not even new. PCR false positive pseudo epidemics exist. We’ve got one. When in a pseudoepidemic everyone thinks it’s a real epidemic. But we don’t have extra deaths. The fascinating thing about test related pseudo epidemics is that they vanish as soon as the aberrant test is halted. Nothing else changes because nothing else is happening.” (Dr. Yeadon says all we have to do is stop the testing and it all goes away, same for that Canadian Pathologist, and Dr. Bhakdi, the Thai/German microbiologist)

And when I'm sending out letter's I also add the info from the Johns Hopkins University study:

***Johns Hopkins University Reveals Manipulated Covid Death Figures https://www.sott.net/article/444898-Johns-Hopkins-University-Reveals-Manipulated-Covid-Death-Figures “The total decrease in deaths by other causes almost exactly equals the increase in deaths by COVID-19. This suggests, according to Briand, that the COVID-19 death toll is misleading. Briand believes that deaths due to heart diseases, respiratory diseases, influenza and pneumonia may instead be recategorized as being due to COVID-19. The CDC classified all deaths that are related to COVID-19 simply as COVID-19 deaths. Even patients dying from other underlying diseases but are infected with COVID-19 count as COVID-19 deaths. This is likely the main explanation as to why COVID-19 deaths drastically increased while deaths by all other diseases experienced a significant decrease. All of this points to no evidence that COVID-19 created any excess deaths. Total death numbers are not above normal death numbers. We found no evidence to the contrary," Briand concluded.

Dachsie
13th December 2020, 04:43 PM
ivremectin

If you take it you will not get sick.

Take as a prophylactic,
which means take as a preventative.

https://www.bitchute.com/video/IZxnZviUvwOF/

Pierre Kory, M.D., Associate Professor of Medicine, St. Luke's Aurora Medical Center, delivers passionate testimony during Senate Homeland Security and Governmental Affairs Committee on "Early Outpatient Treatment: An Essential Part of a C…
MORE
Category News & Politics
Sensitivity Normal - Content that is suitable for ages 16 and over

27 minutes ago
Conspiracy Theory News

What he is saying is that he has a cure-all that assists the immune system's ability to fight off disease IN GENERAL. He is not giving validity to a virus he knows is fake. I take handfulls of supplements daily and I don't get sick. If I could get some ivermectin I'd keep it in the medicine cabinet just in case. Another is budesonide. It's an inhaler that reduces lung inflamation. It is available over the counter as entocort, rhinocort and pulmicort. Keep those in the cabinet and throw away the frikken masks!
[show less]

··

Dachsie
14th December 2020, 06:42 AM
As an interesting aside, two of the experimental "corona" vaccine makers are infested with Tony-the-Rat communist spies.

"“Detailed analysis” has revealed that Pfizer and AstraZeneca employed 123 “party loyalists,” "

https://www.dailywire.com/news/breaking-huge-data-leak-exposes-chinese-communist-party-members-embedded-in-western-companies-and-governments?utm_campaign=dw_newsletter&utm_medium=email&_hsmi=102910126&_hsenc=p2ANqtz-_o0Ea_VtY77JFTCjbhi7CXJvwMP4agEDw0vQLD5CUDpFOg7Vux 6TmGt93kz4yw6axPWX5G6FYvZZhmMHgLuP63Ksd-zw&utm_content=non_insiders&utm_source=housefile

Report: Huge Data Leak ‘Exposes’ Chinese Communist Party Members ‘Embedded’ In Western Companies And Governments
By Ian Haworth

Dec 13, 2020 DailyWire.com

woodman
14th December 2020, 07:31 AM
Great post Amanda. I have had a hard time trying to figure out whether to keep going with my position of 'no such thing as Covid19' when talking to sheep, or not. I still believe that it is just the flu and nothing new.

Hey, that could be a catchy 'wake up' phrase: "It's just the flu and nothing new."

Amanda
14th December 2020, 01:40 PM
Great post Amanda. I have had a hard time trying to figure out whether to keep going with my position of 'no such thing as Covid19' when talking to sheep, or not. I still believe that it is just the flu and nothing new.

Hey, that could be a catchy 'wake up' phrase: "It's just the flu and nothing new."

Yes, I usually say there's nothing new, they're hijacking the flu. Then I mention the whole thing about no excess deaths and how if we were truly in a "deadly pandemic" then we should see higher total deaths this year, but we don't. And then I pretty much quote Dr. Yeadon's twitter verbatum (I've said it so much, it's just about committed to memory).

For most, I don't bother with the no Koch's postulates, no isolation--that's too complicated for people who are clueless. But I do go over the fraud with the PCR because that's the key to the whole psyop. (I've also noticed that most brain-dead sheep have no understanding of psyops--they literally do not know that this is what the media does, so they see those photos of people all hazmat suited up like they are facing a deadly plague and the sheep fall for it!)

Dachsie
15th December 2020, 06:18 AM
https://www.bitchute.com/video/DxolIH72vHZj/

1:03:58 video runtime




https://static-3.bitchute.com/live/cover_images/Rbtrop3rRlZl/DxolIH72vHZj_640x360.jpg


Dec 08, 2020
The Great Lies - COVID19 & The Great Reset

First published at 21:59 UTC on December 8th, 2020.

channel image

Jim Fetzer

Jim Fetzer

2040 subscribers

Muckraking investigator & Need to Know regular Giuseppe Vafanculo produced a documentary exposing the 9 Great Lies of COVID-19 & The Great Reset fueling the gaslighting mind-control by the Satanic Globalist Parasites. It premiered December 6th at Dr Jim Fetzer's inaugural virtual conference https://falseflagconspiracies2020.com/
LESS
Category News & Politics
Sensitivity Normal - Content that is suitable for ages 16 and over

Dachsie
16th December 2020, 06:22 PM
https://www.zerohedge.com/geopolitical/did-covid-murder-flu

Did COVID Murder The Flu?
Tyler Durden's Photo
by Tyler Durden
Tuesday, Dec 15, 2020 - 18:25

Despite Dr. Fauci's cries about how all vulnerable Americans should make sure to get their flu shots to protect against a deadly vortex of a COVID-19-supercharged flu season "twindemic", it appears influenza-related infections, hospitalizations and confirmed cases over the past couple of months have been much, much lower than the 'experts' had anticipated.

And on Tuesday, one day after publishing an editorial written by bossman Michael Bloomberg where the billionaire urged Joe Biden to "lead" on the fight against climate change (he even suggested Biden mandate sleepy ESG-focused financial disclosures), the financial news behemoth has decided to boldly question the accepted "science" (accepted by Bloomberg and many of its competitors, at least) about the brutality of the 2020-2021 flu season. SNIP

"Well, folks. There you have it.

Now, are we supposed to believe Dr. Fauci & Co. weren't able to anticipate this back in the summer?

Or were the warnings about the "twindemic" instead pushed subtly by big pharma to keep sales growing and, perhaps, provide more "buffer" to pour into development of the new COVID-19 vaccine...or at least maybe that's what they would like you to believe.

Paul Craig Roberts from the IPE expanded on all of this in a recent piece:

Is there no flu this year or is flu “the second wave of Covid?” Don’t expect any honest answer from health authorities. They have the fear running strong, so strong that people are submitting to needless lockdowns that are causing economic havoc to their lives and to mask mandates that do more harm than good.

What is it all about?

Is it simply about vaccine profits for Big Pharma?

Or is it about getting people accustomed to arbitrary orders unsupported by legislation? Isn’t what we are experiencing a takeover of our lives by the executive part of government?

Or is it about reducing human fertility? Experts report that the American vaccine contains anti-fertility elements that will make a percentage of the female population infertile. Why is there no public discussion of this? There are also expert concerns about the novelty of the way the vaccine is supposed to work. It is an approach never before used and has not had sufficient trials to know the consequences.

Just some food for thought." EMD

Dachsie
17th December 2020, 11:36 AM
Important message of this video. Who designed it? Who released it"


Partial Transcript:
https://www.bitchute.com/video/DxolIH72vHZj/
03:25
The Great Lies - COVID19 & The Great Reset

COVID-19 was in reality two separate events merged into one worldwide terrifying deception.

1. The first event was a rebranding of a typical worldwide cold/flu season as a pandemic.
If this year was a pandemic then every cold/flu season was a pandemic because the number of deaths were no different. Check the actuary tables.

2. The second event was the “accidental” but intentional release of the gain-of-function enhanced bioweapon SARSCov-2.
Now this bioweapon was intentionally released and intentionally very attenuated, which means really really taking the killing edge off. It’s not designed to kill you. It is designed to make you sick and have your chest cold for quite a while.

Transcript end: 04:19

Dachsie
17th December 2020, 02:31 PM
https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-december-16-2020

02:58 Dr. Tony-the Rat Fauci
05:17 Dr. Carrie Madej
08:19 Tom Cruz rant

_______________
https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-december-17-2020

CORONACRAZY NEWS
3:03 TO 10:47

Dachsie
17th December 2020, 06:53 PM
https://www.bitchute.com/channel/Rbtrop3rRlZl/


https://www.bitchute.com/channel/Rbtrop3rRlZl/

First published at 01:07 UTC on December 18th, 2020.
51:16 video runtime

https://static-3.bitchute.com/live/cover_images/Rbtrop3rRlZl/413by7F49ewS_640x360.jpg


channel image

Jim Fetzer

Jim Fetzer

2099 subscribers

Dr. Tom Cowan Interviews medical journalist and author, Jon Rappoport. For those of you who have been following my work concerning COVID-19, you know that the entire foundation of the story of the virus rests on whether the novel “corona virus” has been properly isolated and its entire genome characterized. Many of you have sent papers to me that have been published in prestigious peer-reviewed journals that claim to have isolated and characterized this new virus. They are all incorrect.

In fact, the original Corman-Drosten et al paper on which this edifice of viral causation is based states that they used an “in silico” genome of an “in silico” virus. “In silico” is Latin for “theoretical.” In common English, synonyms for theoretical are “imaginary” or “make-believe.”

The CDC in its July 2020 monograph states “no quantified isolated of the 2019-nCov are available.” Again, in simple English, this means they have no examples of an isolated virus in their possession. In Freedom of Information requests, the Canadian health ministry, the Australian health ministry and the governments of many Commonwealth countries admit that they do not possess any studies that show the isolation of this purported virus.

In this interview, and hopefully for the final time, Jon Rappaport and I describe in common language and precise detail the steps that are needed to properly isolate and characterize a virus. We did this so we could empower our readers and listeners to know for themselves how to read and identify fraudulent science. Among the many challenges we face, one is the rampant scientific illiteracy. In some ages this may not have been relevant, but if we are going to live in an era in which “science” is the new religion and its tenets control our lives, we had better understand what its unquestioned “priests” are saying.

Mirrored from: https://www.youtube.com/watch?v=R6-8VRGvNtQ
LESS
Category News & Politics
Sensitivity Normal - Content that is suitable for ages 16 and over

monty
17th December 2020, 07:25 PM
Toda y I went to the fda website to print a copy. The. CDC has revised the document and removed that statement from the paper

Amanda
17th December 2020, 09:43 PM
Toda y I went to the fda website to print a copy. The. CDC has revised the document and removed that statement from the paper

is there anyway to get a screen shot from when it used to say that. So, I guess they realized people were onto the scam?

monty
17th December 2020, 09:57 PM
is there anyway to get a screen shot from when it used to say that. So, I guess they realized people were onto the scam?.

Jon Rappoport upset their canoe.

I have a copy of page 39 of the original before they scrubbed it

I scanned it and saved the file also.

I’ll see if I can upload the .pdf.

monty
17th December 2020, 10:24 PM
Page 39 CDC Emergency Instructions for Covid Testing

I marked it up with a highliter and smuged the print. That is why I wanted another copy

https://i.postimg.cc/PqGxx2kM/4-D83-A6-AB-A844-41-FC-BC9-C-D40684-D7404-F.jpg

Dachsie
18th December 2020, 01:23 AM
I found this ,,,

https://www.fda.gov/media/134922/download
CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel For Emergency Use Only Instructions for Use

Page 42


Analytical Performance: Limit of Detection (LoD): LoD studies determine the lowest detectable concentration of 2019-nCoV at which approximately 95% of all (true positive) replicates test positive. The LoD was determined by limiting dilution studies using characterized samples. The analytical sensitivity of the rRT-PCR assays contained in the CDC 2019 Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel were determined in Limit of Detection studies. Since no quantified virus isolates of the 2019-nCoV were available for CDC use at the time the test was developed and this study conducted, assays designed for detection of the 2019-nCoV RNA were tested with characterized stocks of in vitro transcribed full length RNA (N gene; GenBank accession: MN908947.2) of known titer (RNA copies/μL) spiked into a diluent consisting of a suspension of human A549 cells and viral transport medium (VTM) to mimic clinical specimen. Samples were extracted using the QIAGEN EZ1 Advanced XL instrument and EZ1 DSP Virus Kit (Cat# 62724) and manually with the QIAGEN DSP Viral RNA Mini Kit (Cat# 61904). Real-Time RT-PCR assays were performed using the Thermo Fisher Scientific TaqPath™ 1-Step RT-qPCR Master Mix, CG (Cat# A15299) on the Applied Biosystems™ 7500 Fast Dx Real-Time PCR Instrument according to the CDC 2019-nCoV Real-Time RT-PCR Diagnostic Panel instructions for use.

A preliminary LoD for each assay was determined testing triplicate samples of RNA purified using each extraction method. The approximate LoD was identified by extracting and testing 10-fold serial dilutions of characterized stocks of in vitro transcribed full-length RNA. A confirmation of the LoD was determined using 3-fold serial dilution RNA samples with 20 extracted replicates. The LoD was determined as the lowest concentrationwhere≥95%(19/20)ofthereplicateswerepositive

woodman
18th December 2020, 05:34 AM
I found this ,,,

https://www.fda.gov/media/134922/download
CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel For Emergency Use Only Instructions for Use

Page 42


Analytical Performance: Limit of Detection (LoD): LoD studies determine the lowest detectable concentration of 2019-nCoV at which approximately 95% of all (true positive) replicates test positive. The LoD was determined by limiting dilution studies using characterized samples. The analytical sensitivity of the rRT-PCR assays contained in the CDC 2019 Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel were determined in Limit of Detection studies. Since no quantified virus isolates of the 2019-nCoV were available for CDC use at the time the test was developed and this study conducted, assays designed for detection of the 2019-nCoV RNA were tested with characterized stocks of in vitro transcribed full length RNA (N gene; GenBank accession: MN908947.2) of known titer (RNA copies/μL) spiked into a diluent consisting of a suspension of human A549 cells and viral transport medium (VTM) to mimic clinical specimen. Samples were extracted using the QIAGEN EZ1 Advanced XL instrument and EZ1 DSP Virus Kit (Cat# 62724) and manually with the QIAGEN DSP Viral RNA Mini Kit (Cat# 61904). Real-Time RT-PCR assays were performed using the Thermo Fisher Scientific TaqPath™ 1-Step RT-qPCR Master Mix, CG (Cat# A15299) on the Applied Biosystems™ 7500 Fast Dx Real-Time PCR Instrument according to the CDC 2019-nCoV Real-Time RT-PCR Diagnostic Panel instructions for use.

A preliminary LoD for each assay was determined testing triplicate samples of RNA purified using each extraction method. The approximate LoD was identified by extracting and testing 10-fold serial dilutions of characterized stocks of in vitro transcribed full-length RNA. A confirmation of the LoD was determined using 3-fold serial dilution RNA samples with 20 extracted replicates. The LoD was determined as the lowest concentrationwhere≥95%(19/20)ofthereplicateswerepositive
"to mimic clinical specimen." This means it was faked. Plain and simple statement of fact. Good to get some truth from the CDC, even if they remove it later.

It would be nice to get a layman translation of the entire page.

Dachsie
18th December 2020, 02:42 PM
Update: Lin Wood Puts Evidence Against Justice Roberts In Protective Custody Of Third Parties
17,200 views
•Dec 18, 2020
6.1K31Share
Save
The Werff Report
28.4K subscribers
Third Party Protection! Lin Wood tweeting that he has placed documentation he has of his claims concerning failed Supreme Court Justice John Roberts into the hands of several quote “third parties” for protection. SUPPORT THE WERFF REPORT: https://fundly.com/the-werff-report-k... SUBSCRIBE ON RUMBLE: https://rumble.com/c/TheWerffReport

first 7:53 minutes interesting corona news. Good report on scoliosis treatment at end.

TruNews Headlines with Kerry Kinsey - December 18, 2020

A nurse in Chattanooga, Tennessee collapses on live television after getting the Coronavirus vaccine, in El Paso, Texas it appears a nurse didn’t depress the plunger on a syringe during a similar hospital vaccine event, pressure from social media forces the hospital to do it over the next day, now that the Moderna vaccine is out medical experts from around the world are saying that not only is there no Coronavirus Pandemic, but that the vaccine is dangerous because it never went through animal trials and there was a race to produce it, on "Corona. Crazy,’ in Bolivia one of the most popular Christmas decorations this year is a figurine of a “Baby Jesus,” wearing a face mask and a hazmat suit, and an interesting look at the screws, rods and hooks that helped Kerry Kinsey’s wife Angela recover from scoliosis surgery thanks to a 60 degree curve in her spine, it’s a fascinating story about the "Daytona Deformity System’
Content Contributed By — TruNews Team

Take the broadcast with you!

monty
18th December 2020, 03:18 PM
I found this ,,,

https://www.fda.gov/media/134922/download
CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel For Emergency Use Only Instructions for Use

Page 42


Analytical Performance: Limit of Detection (LoD): LoD studies determine the lowest detectable concentration of 2019-nCoV at which approximately 95% of all (true positive) replicates test positive. The LoD was determined by limiting dilution studies using characterized samples. The analytical sensitivity of the rRT-PCR assays contained in the CDC 2019 Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel were determined in Limit of Detection studies. Since no quantified virus isolates of the 2019-nCoV were available for CDC use at the time the test was developed and this study conducted, assays designed for detection of the 2019-nCoV RNA were tested with characterized stocks of in vitro transcribed full length RNA (N gene; GenBank accession: MN908947.2) of known titer (RNA copies/μL) spiked into a diluent consisting of a suspension of human A549 cells and viral transport medium (VTM) to mimic clinical specimen. Samples were extracted using the QIAGEN EZ1 Advanced XL instrument and EZ1 DSP Virus Kit (Cat# 62724) and manually with the QIAGEN DSP Viral RNA Mini Kit (Cat# 61904). Real-Time RT-PCR assays were performed using the Thermo Fisher Scientific TaqPath™ 1-Step RT-qPCR Master Mix, CG (Cat# A15299) on the Applied Biosystems™ 7500 Fast Dx Real-Time PCR Instrument according to the CDC 2019-nCoV Real-Time RT-PCR Diagnostic Panel instructions for use.

A preliminary LoD for each assay was determined testing triplicate samples of RNA purified using each extraction method. The approximate LoD was identified by extracting and testing 10-fold serial dilutions of characterized stocks of in vitro transcribed full-length RNA. A confirmation of the LoD was determined using 3-fold serial dilution RNA samples with 20 extracted replicates. The LoD was determined as the lowest concentrationwhere≥95%(19/20)ofthereplicateswerepositive

Look at the information on this website, mind boggling

https://www.fluoridefreepeel.ca/fois-reveal-that-health-science-institutions-around-the-world-have-no-record-of-sars-cov-2-isolation-purification/ Thanks to Jon Rappoport

Dachsie
18th December 2020, 03:51 PM
I started wondering if even SARS Cov-1, first heard of "SARS' in the "outbreak of 2003-2004. wondering if even that disease had any evidence of isolation.

I am thinking it does not and from what they said on that video, not HIV, not SARS, not MERS. not COVID anything has ever been proven to exist. Existence is proven by real science including electron microscopy of several specimens in a properly constructed study.

https://upload.wikimedia.org/wikipedia/commons/thumb/c/cf/SARS_virion.gif/300px-SARS_virion.gif

https://upload.wikimedia.org/wikipedia/commons/thumb/c/cf/SARS_virion.gif/300px-SARS_virion.gif

Electron micrograph of SARS coronavirus virion

Pronunciation • /sɑːrz/

Specialty
Infectious disease

Symptoms Fever, persistent dry cough, headache, muscle pains, difficulty breathing
Complications
Acute respiratory distress syndrome (ARDS) with other comorbidities that eventually leads to death
Causes Severe acute respiratory syndrome coronavirus (SARS-CoV-1)
Prevention Hand washing, cough etiquette, avoiding close contact with infected persons, avoiding travel to affected areas[2]

Prognosis 9.5% chance of death (all countries)
Frequency 8,098 cases
Deaths 774 known



https://en.wikipedia.org/wiki/Severe_acute_respiratory_syndrome


We have seen almost no electron microscope images. All we get is that computer graphics art / image that is total nonsense.

All we know is that Wiki tells us that image is of

Electron micrograph of "SARS coronavirus virion"


That seems like utter nonsense to me.

Dachsie
18th December 2020, 06:27 PM
This two hour show halfway through started reporting on COVID and the Vaccine. The subject matter lends itself to comedic commentary and there is plenty of that in tonight's Godcast show. Lots of laughs here.

https://www.trunews.com/stream/in-like-flynn-will-u-s-troops-oversee-2nd-election-in-swing-states

In Like Flynn: Will U.S. Troops Oversee 2nd Election in Swing States?
Content Contributed By — TruNews Team

Take the broadcast with you!

Dachsie
20th December 2020, 06:15 AM
Dec 08, 2020
The Great Lies - COVID19 & The Great Reset

First published at 21:59 UTC on December 8th, 2020.

channel image

Jim Fetzer

Jim Fetzer

2040 subscribers

Muckraking investigator & Need to Know regular Giuseppe Vafanculo produced a documentary


____________

In Hour number 1 of Giuseppe's Friday Dec. 18 The Perfect Triangle Revolution Radio show at about 11:20 on the audio track Giuseppe again stated his "theory" that THEY have designed and released a very weak attenuated bioweapon that THEY variously refer to as Coronavirus, COVID - 19, and SARS Cov 2. This is basically a lingering chest cold that causes serious health problem for those with an average of three other serious medical conditions ( comorbidities ).

There was a real serious bioweapon released in a planned and scammed way but it has nothing to do with what THEY tell the public Coronavirs, COVID-19 and SARSCov2 are. Every bit of "information" conveyed to the public about "the virus" has been lie upon lie upon lie to destroy our country and its people and bring in a One World Death and Slavery System for All.

Giuseppe described the propaganda fear / panic disinformation fed to the public as "satanic cabalistic magicians" to accomplish the great reset.

https://www.revolutionradioarchives.com/files/The%20Perfect%20Triangle/

Free downloadable audio archives of all Revolution Radio shows available here

https://www.revolutionradioarchives.com/


Guiseppe speculated as to the way in which the bioweapon was released and suggested it is through the flu shot. I noticed the medical establishement is really really pushing the flu shot this year. I have never taken the flu shot but one thing I can say with certainty is that if you take it you will get the flu and probably a pretty bad case of it.

P.S.

Guiseppe did make his radio show available on his YouTube channel as a video

https://www.youtube.com/channel/UCGPNiZKHT-676P5f5-l3oeQ

but YT is censoring him big time.

I do not know if Dr. Fetzer will repost The Perfect Triangle show in video form on his BitChute channel,

https://www.youtube.com/channel/UCGPNiZKHT-676P5f5-l3oeQ

but it does not look like it.

Maybe Guiseppe and Scorpio can start a BitChute channel.

Dachsie
20th December 2020, 07:18 AM
Dr. James Fetzer is the guest on the Dec. 18 Republic Broadcasting "Uncernsored" show of host Rick Adams.

https://static-3.bitchute.com/live/cover_images/Rbtrop3rRlZl/jSzWRAkHZQLh_320x180.jpg

(Dachsie is appreciative of Rick Adams' introductory comments of this show highlighting the FACT of Mary's genealogy in the Gospel of Luke. Joseph was of the House of David through Solomon (genealogy given in gospel of Mathew) but Mary was descended of the House of David through Nathan, Solomon's brother. I think it is important to give the truth that Mary is PHYSICALLY descended of the House of David (Joseph is the foster father of Jesus and is not physically related to Jesus). With the exception of Dr Robert Sungenis, I cannot find any novus ordo or sedevacantist or traditional Catholic theologian to tell us the FACTS about this. It looks like biblical exegesis has been co-opted by the tribe too. I am most disappointed that truth about this fact is universally lacking where it should be highlighted right now.)

https://www.bitchute.com/video/jSzWRAkHZQLh/


https://www.bitchute.com/video/jSzWRAkHZQLh/

1:17:00 video runtime

First published at 21:15 UTC on December 19th, 2020.

channel image

Jim Fetzer

Jim Fetzer

2141 subscribers

On the Great COVID-19 Hoax and Theft of the 2020 Election Lively discussion of the faking of the pandemic to justify the use of mail-in ballots to steal the 2020 Election and promote the end of America as we know it through The Great Reset. Several callers and lots of information about how even the Chief Justice of the United State has been compromised as a guest of Jeffrey Epstein on Orgy Island and declared (to Justice Breyer) that he would never allow Trump to be re-elected, prompting L. Lin Woods to call for him to step down from the case and resign from the Supreme Court.
LESS

Dachsie
20th December 2020, 10:36 AM
https://www.forbes.com/sites/roberthart/2020/10/20/researchers-warn-some-covid-19-vaccines-could-increase-risk-of-hiv-infection/?fbclid=IwAR0HNBYmLpQazno2316KZA8JEwDrrQhJpz31aUux zIfbvs61rPBNX_E-Wg4&sh=5c86757a3740

https://specials-images.forbesimg.com/imageserve/5f8f201c51d91555816e877b/960x0.jpg?cropX1=0&cropX2=5168&cropY1=0&cropY2=3444


Editors' Pick|Oct 20, 2020,01:43pm EDT|1,257,499 views

Researchers Warn Some Covid-19 Vaccines Could Increase Risk Of HIV Infection

Robert Hart
Robert HartForbes Staff
Business
I cover breaking news.

Topline

Some of the Covid-19 vaccines currently in development could increase the risk of acquiring HIV, warned a group of researchers in the The Lancet medical journal Monday, potentially leading to an increase in infections as vaccines are rolled out to vulnerable populations around the world.
Coronavirus COVID-19 medical test vaccine research and development

Some Covid-19 vaccines could increase risk of HIV infection, warn researchers who have seen ... [+] getty
Key Facts

The researchers warn of a “cautionary tale” from efforts to create an HIV vaccine over a decade ago, where a promising vaccine candidate actually increased the risk of some men catching the virus.

The vaccine made use of a modified virus — called adenovirus 5 (Ad5) — as a vector to transport some of HIV’s genetic material into the body.

Exactly how the vaccine increased the risks of HIV transmission is unknown, but a conference convened by the National Institutes of Health recommended against further use of Ad5 as a vector in HIV vaccines (Dr. Anthony Fauci was lead author of the paper outlining this position.)

Ad5 is used as a vector in some Covid-19 vaccines — Science identifies four such candidates that are currently undergoing clinical trials in various countries around the world, including the U.S., with two in large scale phase 3 trials ongoing in Russia and Pakistan.

The researchers stressed the need to understand the role Ad5 might play in increasing the risks of HIV in vulnerable populations before developing and deploying vaccines using the vector, adding that informed consent documents should reflect the “considerable literature” on the risk of HIV acquisition with Ad5 vectors.
Key Background

Lots of vaccines make use of modified viruses to transport material into the human body. Many make use of a modified adenovirus to do this, a virus which is usually harmless except the ability to cause the common cold. Some of the leading candidates for a Covid-19 vaccine, including those from Johnson & Johnson and AstraZeneca, use adenoviruses as vectors. There is no evidence that those vectors increase the risk of HIV infection.
Crucial Quote

The authors said they went public because Ad5 vaccines for Covid-19 might soon be tested in populations with high HIV prevalence. Lawrence Corey, one of the authors who now co-leads the Covid-19 prevention network in the U.S. that is testing vaccines on behalf of the NIH, told Science that if he were in a sub-Saharan African country, where there’s a high prevalence of HIV, “I don’t see why I would pick an Ad5 vector (vaccine) when there are many other alternative choices.”
Further Reading

Could certain COVID-19 vaccines leave people more vulnerable to the AIDS virus? (Science)

Use of adenovirus type-5 vectored vaccines: a cautionary tale (The Lancet)

Full coverage and live updates on the Coronavirus
Follow me on Twitter. Send me a secure tip.
Robert Hart
Robert Hart

I am a London-based reporter for Forbes covering breaking news. Previously, I have worked as a reporter for a specialist legal publication covering big data and as a…

Print
Reprints & Permissions

Dachsie
21st December 2020, 03:08 PM
Rand Paul's 12 minute rant in congress today regarding the new stimulus bill, a bill that did pass.

I do not agree with Rand Paul's economic philosophy or his solutions.

He does point out the ridiculousness of the goverment's "COVID" regulations and that is valuable.

There will be no solution to the problems that were born of the "COVID pandemic"

until Rand Paul and every other subversive oligarchs care about USA national sovereignty first and realize that COVID was never real.

It was a PLAN and a SCAM from the beginning and the goal is a one world death and slavery system for all.


https://www.youtube.com/watch?v=X-nyvBfhT90

...https://www.youtube.com/watch?v=X-nyvBfhT90...

Rand Paul ERUPTS on Senate Floor Over COVID Stimulus That Will Hand Out $600 Checks
48,744 views
•Dec 21, 2020
5.9K
178
Share
Save
BlazeTV
1.33M subscribers
Senator Rand Paul just went off on the Senate floor over the COVID-19 stimulus bill about to be passed through congress. WATCH McConnell drop NUKE on Dems after finally agreeing on COVID-19 relief: https://www.youtube.com/watch?v=wL3in...

Dachsie
21st December 2020, 03:39 PM
THIS ONE IS IMPORTANT !





https://www.youtube.com/watch?v=RZDr3CsfolA

...https://www.youtube.com/watch?v=RZDr3CsfolA...

3:41 video runtime

Prof. Sucharit Bhakdi from Germany got it to the point @Laura Ingraham (Fox News) on 2. 12. 2020
61,349 views
•Premiered Dec 3, 2020
1.6K
28
Share
Save
Blue 1986
257 subscribers
I uploaded this video on behalf of investigative journalist Oliver Janich whose channel was recently deleted by Youtube: https://www.oliverjanich.de/about-me

Further information: https://rairfoundation.com/warning-re...

Telegram Channel Oliver Janich:
https://t.me/oliverjanich

Dachsie
21st December 2020, 10:17 PM
source article

https://www.who.int/news/item/14-12-2020-who-information-notice-for-ivd-users


WHO Information Notice for IVD Users
Nucleic acid testing (NAT) technologies that use real-time polymerase chain reaction (RT-PCR) for detection of SARS-CoV-2
14 December 2020 Medical product alert
Geneva
Reading time: 2 min (554 words)
العربية
中文
Français
Русский
Español
Português



Product type: Nucleic acid testing (NAT) technologies that use real-time polymerase chain reaction (RT-PCR) for detection of SARS-CoV-2

Date: 7 December 2020

WHO-identifier: 2020/5, version 1

Purpose of this notice: To ensure users of certain nucleic acid testing (NAT) technologies are aware of certain aspects of the instructions for use (IFU) for all products.

Description of the problem: WHO has received user feedback on an elevated risk for false SARS-CoV-2 results when testing specimens using RT-PCR reagents on open systems.

As with any diagnostic procedure, the positive and negative predictive values for the product in a given testing population are important to note. As the positivity rate for SARS-CoV-2 decreases, the positive predictive value also decreases. This means that the probability that a person who has a positive result (SARS-CoV-2 detected) is truly infected with SARS-CoV-2 decreases as positivity rate decreases, irrespective of the assay specificity. Therefore, healthcare providers are encouraged to take into consideration testing results along with clinical signs and symptoms, confirmed status of any contacts, etc." SNIP

________________________

Here is the same information given in more layman's terms.

https://principia-scientific.com/who-finally-admits-covid19-pcr-test-has-a-problem/

WHO Finally Admits COVID19 PCR Test Has a ‘Problem’

Published on December 17, 2020

Written by John O'Sullivan

In a statement released on December 14, 2020 the World Health Organization finally owned up to what 100,000’s of doctors and medical professionals have been saying for months: the PCR test used to diagnose COVID-19 is a hit and miss process with way too many false positives.

This WHO-admitted “Problem” comes in the wake of international lawsuits exposing the incompetence and malfeasance of public health officials and policymakers for reliance on a diagnostic test not fit for purpose.

This World Health Organization admission is that the crux of the “problem” is a wholly arbitrary cycling process which “means that many cycles were required to detect virus. In some circumstances, the distinction between background noise and actual presence of the target virus is difficult to ascertain.” [emphasis added]

The UN body is now clearly looking to distance itself from the fatally flawed test as a growing number of lawsuits are processing through the courts exposing the insanity of relying on a test that even the inventor, Professor Kary B. Mullis said was never designed to diagnose diseases. [1]

Professor Mullis was awarded the Nobel Prize in Chemistry in 1993. ‘Coincidentally’, Mullis died just before the pandemic started.

We reported on November 22, 2020 that a landmark court case in Portugal had ruled that the polymerase chain reaction test (PCR) used worldwide to diagnose COVID-19 was not fit for purpose. Most importantly, the judges ruled that a single positive PCR test cannot be used as an effective diagnosis of infection.

As Off-Guardian.org reported at the time:

“In their ruling, judges Margarida Ramos de Almeida and Ana Paramés referred to several scientific studies. Most notably this study by Jaafar et al., which found that – when running PCR tests with 35 cycles or more – the accuracy dropped to 3%, meaning up to 97% of positive results could be false positives.

The ruling goes on to conclude that, based on the science they read, any PCR test using over 25 cycles is totally unreliable. Governments and private labs have been very tight-lipped about the exact number of cycles they run when PCR testing, but it is known to sometimes be as high as 45. Even fearmonger-in-chief Anthony Fauci has publicly stated anything over 35 is totally unusable.”

You can read the complete ruling in the original Portuguese here, and translated into English here.

Among thousands of angry doctors arguing PCR tests should not be used is Dr. Pascal Sacré. He wrote that:

“This misuse of RT-PCR technique is used as a relentless and intentional strategy by some governments, supported by scientific safety councils and by the dominant media, to justify excessive measures such as the violation of a large number of constitutional rights, the destruction of the economy with the bankruptcy of entire active sectors of society, the degradation of living conditions for a large number of ordinary citizens, under the pretext of a pandemic based on a number of positive RT-PCR tests, and not on a real number of patients.”

Clear and conclusive scientific evidence proves that these tests are not accurate and create a statistically significant percentage of false positives. Positive results more likely indicate “ordinary respiratory diseases like the common cold.” [2]

However, none of this is new information to science. These facts were known at least before 2007 after a New York Times report entitled, “Faith in Quick Test Leads to Epidemic That Wasn’t,” (image, above) clearly showed how scientifically inaccurate PCR tests are, featuring many shocking statements from medical experts on the use of these tests, clearly laying out how they result in false positives and lead to dangerous exaggerations and false alarms. [3]

In their 2007 story the New York Times cited a prescient quote from Dr. Elizabeth Talbot, deputy state epidemiologist for the New Hampshire Department of Health and Human Services, who said:

“One of the most troubling aspects of the pseudo-epidemic is that all the decisions seemed so sensible at the time.”

Those who run our public institutions have allowed history to repeat itself. At the head of the line of incompetence and malfeasance is the UN itself. At the media briefing on COVID-19 on March 16, 2020, the WHO Director General Dr Tedros Adhanom Ghebreyesus (photo, below) said:

“We have a simple message for all countries: test, test, test.”

This insanity of testing anyone and everyone, even without symptoms has been an unmitigated global public health scandal and must be stopped. All officials in high places complicit in this crime must be prosecuted.

About the author: John O’Sullivan John is CEO and co-founder (with Dr Tim Ball) of Principia Scientific International (PSI). John is a seasoned science writer and legal analyst who assisted Dr Ball in defeating world leading climate expert, Michael ‘hockey stick’ Mann in the ‘science trial of the century‘. O’Sullivan is credited as the visionary who formed the original ‘Slayers’ group of scientists in 2010 who then collaborated in creating the world’s first full-volume debunk of the greenhouse gas theory plus their new follow-up book.

[1] Kary Mullis : « Le test PCR ne permet pas de savoir si vous êtes malade », vidéo accessible sur YouTube, 9 octobre 2020.

[2] David DeGraw, Torsten Engelbrecht and Konstantin Demeter, https://www.globalresearch.ca/national-security-alert-covid-tests-scientifically-fraudulent-epidemic-false-positives/5720271

[3] New York Times,’Faith in Quick Test Leads to Epidemic That Wasn’t,’ Gina Kolota, Published: January 22, 2007
Please Donate Below To Support Our Ongoing Work To Expose The Lies About COVID19

PRINCIPIA SCIENTIFIC INTERNATIONAL, legally registered in the UK as a company incorporated for charitable purposes. Head Office: 27 Old Gloucester Street, London WC1N 3AX.

Dachsie
22nd December 2020, 08:54 AM
Children, Women of child bearing age, and frail elderly people should not be given this truly evil vaccine only useful to kill and reduce population.


SIZE=4]


https://mailchi.mp/cplaction/xupg8jp4tl-1869858?e=38a1706540

https://gallery.mailchimp.com/ee2bb8f7c889f98654f194596/images/c41e190d-926b-404d-9827-2f16109a7803.png

COVID-19 Vaccine: High Risk Briefing Paper
View this email in your browser

December 22, 2020

Briefing Paper on COVID-19 Vaccines for Children and Women of Childbearing Age
The Child Protection League educates citizens on issues that protect or threaten the safety of children. The following Briefing Paper is not medical advice. We are not physicians. However, our research is taken from professional doctors and medical researchers. CPL offers the Briefing because we believe it can contribute to people making informed decisions about their children, their future families, and public policy.
Recent Headline: Doctor on CNN: Don’t be “alarmed” if elderly die after receiving COVID vaccine[i]

"A doctor told CNN that nobody should be “surprised” to see reports of “multiple people dying” at long-term care facilities a day or two after having received the COVID vaccine."

The article explains that the vaccine has not been tested on frail elderly persons so we have no idea what will happen. Take note of what this doctor is saying, “Multiple people dying” and the “Vaccines have not been tested on the frail elderly.”

On what other populations has this vaccine not been tested? Children under age 16 and pregnant women or women who may become pregnant. Why would we give this experimental vaccine to populations where no testing has been conducted? Nevertheless, strong voices in our country are calling for administering COVID-19 vaccinations to all children.
The following provides information concerning the high risks associated with administering COVID-19 vaccines to these two populations: children and childbearing age women.

1) Children under the age of 20

America’s Frontline Doctors[ii] detail the following known facts in their Position Paper on COVID-19 Experimental Vaccines.[iii]

More than 46,000 children were hospitalized for flu in the 2018-19 period, with the hospitalization rate among children 5 to 17 of 39.2 children per 100,000 children. For COVID-19, that hospitalization rate is 6 per 100,000 children ages 5 to 17, according to the CDC. In a report detailing the differences between COVID-19 and the flu, the CDC states, "the risk of complications for healthy children is [much] higher for the flu compared to COVID-19." (p. 9)
No testing has been conducted on the vaccine’s safety for children. Considering the survival rate for children who contract the virus is 99.997% [Ibid p. 15], and when the risk of complications for children is higher for the flu than it is for COVID-19 (see above), we can anticipate that the likely complication rate for children who are vaccinated for COVID-19 will be greater than the complication rate for children who contract the virus.

On December 17, 2020, Mayo Clinic had an advisory posted online stating that the COVID-19 vaccine should not be given to children “because researchers don't know enough about how COVID-19 vaccination can affect children, pregnant women or their babies. There is also no data on the safety of COVID-19 vaccines for breastfeeding women.”[iv]

This underscores the principle stated by Scientific American that administering vaccines should be avoided without adequate advance testing.[v]

2) Women of Childbearing Age

The CDC states that no studies have been conducted on the side effects of the vaccines on pregnant women or breastfeeding women or on breast-fed infants.[vi] NPR states that women who were pregnant, breastfeeding or who might become pregnant in the near future were excluded from these studies.vii] In this way, the pharmaceutical companies made certain it would have no information about the potential of the vaccine to cause miscarriages.

The truth of the matter, as stated in the America’s Frontline Doctors Position Paper, is:

"In layman’s terms: getting COVID-19 has been associated with a high risk of mid-pregnancy miscarriage because the placenta fails – but the vaccine may do the exact same thing – but not for just the few weeks of being sick – but forever. Meaning repeated pregnancies would keep failing ~ mid-pregnancy." (p. 21) [Emphasis added.]

The labels on the bottles of the vaccines acknowledge the risk of ill effects on fertility. They say: “it is unknown whether COVID-19 mRNA VaccineBNT162b2 has an impact on fertility.” (Ibid p. 14)

When the manufacturer says the vaccine’s impact on fertility is unknown, we need to proceed with great caution. This is especially true when the survival rate for women under 50 who contract COVID-19 is 99.98% and much lower for those without high-risk comorbidities. (Ibid p. 15)

No coronavirus vaccine has ever been approved before because animal trials have consistently revealed unacceptable side-effects. This may be why the animal studies are being bypassed. (Ibid p. 12) The history of vaccines for other coronaviruses show that none of them pass this test.[viii]

Conclusion
Child Protection League strongly urges policy makers, parents, and the public to carefully consider the available information about the potential high risks associated with the COVID-19 vaccine for children and women of childbearing age.

[A printable pdf version of this Briefing Paper is here, https://cplaction.com/wp-content/uploads/CPL-Briefing-Paper-on-cv-vaccine.pdf]
[i] https://www.lifesitenews.com/news/doctor-on-cnn-dont-be-alarmed-if-elderly-die-after-receiving-covid-vaccine
[ii] https://www.americasfrontlinedoctors.com/ America’s Frontline Doctors is a growing community of member physicians from across the country representing a range of medical disciplines and practical experience on the front lines of medicine.

[iii] America’s Frontline Doctors Position Paper On COVID-19 Experimental Vaccines
https://cplaction.com/wp-content/uploads/2020-FrontlineDrspaper.pdf
[iv] COVID-19 vaccines: Get the facts https://www.mayoclinic.org/diseases-conditions/coronavirus/in-depth/coronavirus-vaccine/art-20484859 This exact quote was conveniently removed from that advisory on December 17, 2020, while we were in the process of writing this information

[v] The Risks of Rushing a COVID-19 Vaccine https://www.scientificamerican.com/article/the-risks-of-rushing-a-covid-19-vaccine/ #15 and #17

[vi] https://www.cdc.gov/vaccines/acip/meetings/downloads/slides-2020-12/slides-12-12/COVID-03-Mbaeyi.pdf

[vii] https://www.npr.org/2020/12/11/945196602/pregnant-people-havent-been-part-of-vaccine-trials-should-they-get-the-vaccine

[viii] https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3335060/
[/SIZE]

ziero0
22nd December 2020, 10:47 AM
https://needtoknow.news/2020/12/colorado-grand-county-coroner-reveals-cause-of-death-was-officially-attributed-to-covid-really-was-gunshot-wounds-in-2-cases/

Gunshot deaths caused by virus

Dachsie
22nd December 2020, 03:38 PM
Dr. Rashi Buttar is outspoken in his skepticism of the nurse in Chattanooga Tennessee recently who "fainted" 17 minutes after getting the vaccine. They are trying hard to present this as a minor unimportant matter and that the vaccine is safe and effective. Dr. Buttar explains otherwise.

There is extreme medical cover-up of this story and it reminds me of an even more extreme coverup. I wonder if the cover-up of the vaccine injuries will be as extreme as the medical establishment's lies regarding the purported 14 to 16 amputees from the April 15, 2013, Boston Marathon "bombing" hoax / drill.

See

https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-december-22-2020

start watching for about 2 minutes beginning at 01:07 .

Dachsie
22nd December 2020, 06:57 PM
https://medicalkidnap.com/2020/12/22/worlds-second-largest-hydroxychloroquine-plant-in-taiwan-blows-up/

-December 22, 2020
Print This Post Print This Post
World’s Second Largest Hydroxychloroquine Plant in Taiwan Blows Up

https://healthimpactnews.com/wp-content/uploads/sites/2/2020/12/taiwan-hydroxychloroquine-plant.jpg

Pharmaceutical factory in Taoyuan City. Image source.

Comments by Brian Shilhavy
Editor, Health Impact News

One of the biggest scandals of the COVID Plandemic is the needless deaths of hundreds of thousands of people who died needlessly because the FDA refused to issue off-label emergency use for hydroxychloroquine (HCQ), a safe drug whose patent ran out years ago, and that thousands of doctors around the world have used effectively, often with a 100% success rate, in treating COVID patients.

We have an entire page in our COVID Information Center covering this scandal.

News sources in Taiwan (thanks to Dr. Meryl Nass for breaking this story here in the U.S.) are reporting that the world’s second largest supplier of raw materials to make HCQ blew up earlier this week, which will most certainly put a strain on the world’s supply of HCQ.

Taiwan English News reports:

An explosion at a pharmaceutical factory in Taoyuan City left two injured and caused a fire early this afternoon, December 20.

People as far as Tamsui District in New Taipei City reported hearing the massive blast shortly after noon. Immediately after the blast, thick black smoke could be seen pouring out of the SCI Pharmtech factory.

While the factory is located close to Taipei Taoyuan International Airport, operations at the airport were not affected, according to reports in United Daily News and ET Today.

The Taoyuan City Fire Department dispatched 76 personnel, 28 fire appliances and 2 ambulances to the scene of the fire.

The cause of the explosion is currently under investigation.

Liberty Times reported that the factory produces hydroxychloroquine APIs, and is the world’s second largest HCQ raw material supplier. (Source.)

Tensions are currently running very high between Taiwan and China, and another news outlet reported:

Around 76 personnel, 28 fire equipment pieces and 2 ambulances were deployed to the area. The workers injured includes a Philippine worker. Both were taken to Chang Gung Memorial Hospital.

The 30-year old Philippine worker is in critical condition after suffering third-degree burns to 90% of his body. He is currently intubated and treated at the specialist burn unit. The other worker, a Taiwanese, suffered a burn to one hand. He was held at the hospital for observation, but was than released after eight hours.

An investigation has been launched to determine the cause of the massive explosion. It has been reported by Liberty Times, that the pharmaceutical company produces hydroxychloroquine APIs. The company is considered to be the second largest hydroxychloroquine raw material supplier in the World.

On the same day a Chinese aircraft carrier and four other navy warships passed through Taiwan strait in the direction of the South China Sea.

Was this sabotage to reduce competition for the new experimental COVID vaccines and drugs?

Was China involved?

Comment on this article at HealthImpactNews.com.

_________
https://focustaiwan.tw/society/202012210021

Taoyuan factory ordered to suspend production in wake of blaze

6 month factory closure per TruNews 122220

Dachsie
23rd December 2020, 06:59 AM
It is enlightening to think about how this "cause of death" on death certificates comes about.

There are harvesters or miners who watch for and grab real deaths, deaths in hospitals or at the scene of false events to officially declare death, such as at Sandy Hook, in order to falsely pump up number of deaths attributed to "COVID-19" to further the Big Lie upon the populace. The fake number of deaths can be handily manipulated to the public as free advertising for their PLANdemic scam lockdowns and killer vaccines.

Every real death is usable to create a false uptick in official number of deaths due to COVID 19, and fake number of deaths is gold to these evildoers who want a One World Death and Slavery System for all. These harvesters and miners of deaths do not want to wait for official death certificate to be fully signed and processed so they grab the death number immediately and twist it, in a semi-official looking way, to make Cause of Death to show COVID-19. (This resembles cops who have their quota of traffic tickets to give out and the more they meet their quotas the better their pay prospects are in their jobs.)


More and more doctors and nurses in hospitals and probably hospital administrators are becoming increasingly disgusted in the Big Lie games they are ordered to participate with in their daily work of healing and caring for the sick. Doctors and nurses have been required to participate in Big Lie crisis acting videos to put out false propaganda Big Lies about some trauma event or some new diseases or some new fake injurious medicine or vaccine. Hospital administrators have to be on TV News shows and Big Lie about the public DeathCare SCAM / PLAN of the day.
Administering the mandated treatment protocols for the patient with a complicated upper respiratory condition, such as putting a fake label (aka diagnosis) and a ventilator on a patient, could very well be administering death to the patient.


Our once-great USA healthcare system has been turned into DeathCare institutes run by Plandemic prostitutes.

Dachsie
23rd December 2020, 02:50 PM
https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-december-23-2020

Pease watch fist 3 minutes of the above video.









https://brandnewtube.com/watch/urgent-news-about-the-covid-19-vaccine_botqwzI8R7UUVY2.html

Thsi video at the above website last 3 minutes 41 seconds.

RGENT News about the Covid-19 Vaccine
79198 Views

In Explosive Topics

International best-selling author, Dr Vernon Coleman MB ChB DSc FRSA, exposes a remarkable truth about the covid-19 vaccine. You must watch and share this. Click on the following link to go to Dr Coleman's website then click on the health button http://www.vernoncoleman.com
Thank you for all your support and kind comments.





https://www.vernoncoleman.com/main.htm

URGENT information about the covid-19 vaccine

Vernon Coleman MB ChB DSc FRSA
Please watch first 3 minutes of this report from UK's Dr. Vernon Coleman.
If 60 million people in the UK get the vaccine, with adverse reaction rate based on data as of Dec. 18, 2020, 1.67 million people will experience serious reactions to the vaccine.
Dr. Coleman says the vaccine should be stopped right noq.

https://www.cdc.gov/vaccines/acip/meetings/downloads/slides-2020-12/slides-12-19/05-COVID-CLARK.pdf

excerpts from original pdf file.

For more information: www.cdc.gov/COVID19Anaphylaxis Following m-RNA COVID-19 Vaccine ReceiptThomas Clark, MD, MPHDecember 19, 2020



December 8, 2020 – UK initiated vaccination with Pfizer-BioNTechCOVID-19 vaccineDecember 9 –UK authorities confirmed 2 cases of anaphylaxis after vaccination Prescribing information for both Pfizer-BioNTechand ModernaCOVID-19 vaccines contains information on anaphylaxis–Severe allergic reaction (e.g., anaphylaxis) to any component of the vaccine is a contraindication to vaccination–Appropriate medical treatment used to manage immediate allergic reactions must be immediately available in the event an acute anaphylactic reaction occurs following administration of the vaccineAnaphylaxis in UK Following COVID-19 Vaccination

December 18*, 2020 – CDC has identified 6 case reports of anaphylaxis following Pfizer-BioNTechvaccine meeting Brighton Collaboration criteria for anaphylaxis –Cases were Brighton Collaboration levels 1 or 2 –Additional case reports have been reviewed and determined not anaphylaxisCases occurred within recommended observation window and were promptly treatedOne case had a history of anaphylaxis following rabies vaccinationAll suspect cases were notified through VAERS or CDC notification processesThese case reports are undergoing/will undergo clinical case review by CISADecember 19** –272,001 doses of vaccine have been administeredAnaphylaxis in US Following COVID-19 Vaccination

Post-authorization pharmacovigilance systems have detected and confirmed 6 anaphylaxis cases following vaccination–Notifications received have been timely–Notifications ruled out suggests systems are sensitive Reinforce measures to recognize, respond, and report anaphylaxisPersons with anaphylaxis following COVID-19 vaccination should not receive additional doses of COVID-19 vaccineConsultation with allergy/immunology experts to provide guidance on evaluation of persons following anaphylaxis to COVID-19 vaccineCDC Assessment and Further Actions

Dachsie
28th December 2020, 12:41 PM
Update: Lin Wood Puts Evidence Against Justice Roberts In Protective Custody Of Third Parties
17,200 views
•Dec 18, 2020
6.1K31Share
Save
The Werff Report
28.4K subscribers
Third Party Protection! Lin Wood tweeting that he has placed documentation he has of his claims concerning failed Supreme Court Justice John Roberts into the hands of several quote “third parties” for protection. SUPPORT THE WERFF REPORT: https://fundly.com/the-werff-report-k... SUBSCRIBE ON RUMBLE: https://rumble.com/c/TheWerffReport

first 7:53 minutes interesting corona news. Good report on scoliosis treatment at end.

TruNews Headlines with Kerry Kinsey - December 18, 2020

A nurse in Chattanooga, Tennessee collapses on live television after getting the Coronavirus vaccine, in El Paso, Texas it appears a nurse didn’t depress the plunger on a syringe during a similar hospital vaccine event, pressure from social media forces the hospital to do it over the next day, now that the Moderna vaccine is out medical experts from around the world are saying that not only is there no Coronavirus Pandemic, but that the vaccine is dangerous because it never went through animal trials and there was a race to produce it, on "Corona. Crazy,’ in Bolivia one of the most popular Christmas decorations this year is a figurine of a “Baby Jesus,” wearing a face mask and a hazmat suit, and an interesting look at the screws, rods and hooks that helped Kerry Kinsey’s wife Angela recover from scoliosis surgery thanks to a 60 degree curve in her spine, it’s a fascinating story about the "Daytona Deformity System’
Content Contributed By — TruNews Team

Take the broadcast with you!


https://static-3.bitchute.com/live/cover_images/SXmgjcmP7aON/LLCwKkq1CtAJ_640x360.jpg

Here is a follow up on Tiffany Dover, 30 year old Registered Nurse who passed out 17 minutes after taking the "virus" vaccine and passed out on live TV feed where she is praising the vaccine and saying she is so happy about having taken the vaccine.

Dr. Fetzer did a recent reporting on his show that Ms. Dover has not been heard from since and there may be even a body double person for Ms. Dover in propaganda pieces put out by the hospital where she worked.

The story is that Tiffany Dover died. We really have no sure way of verifying this but here is the basis for this latest rumor about Tiffany Dover, mother of two children.

https://www.bitchute.com/video/LLCwKkq1CtAJ/

10:07 video runtime

First published at 00:50 UTC on December 26th, 2020.

channel image

beyondtheicea

beyondtheicea

1959 subscribers

TIFFANY PONTES DOVER FAINTS IN 17 MINS, DEAD IN 10 HOURS
https://www.bitchute.com/video/as1rvnNFNaQQ/
Sergeant Major
https://www.bitchute.com/channel/rzUd1ovwJXug/
SERGEANT MAJOR'S TRUTHER INFO

NURSE TIFFANY PONTES DOVER gets Pfizer mRNA Vaccine l…

Dachsie
28th December 2020, 01:28 PM
https://static-3.bitchute.com/live/cover_images/SXmgjcmP7aON/LLCwKkq1CtAJ_640x360.jpg

Here is a follow up on Tiffany Dover, 30 year old Registered Nurse who passed out 17 minutes after taking the "virus" vaccine and passed out on live TV feed where she is praising the vaccine and saying she is so happy about having taken the vaccine.

Dr. Fetzer did a recent reporting on his show that Ms. Dover has not been heard from since and there may be even a body double person for Ms. Dover in propaganda pieces put out by the hospital where she worked.

The story is that Tiffany Dover died. We really have no sure way of verifying this but here is the basis for this latest rumor about Tiffany Dover, mother of two children.

https://www.bitchute.com/video/LLCwKkq1CtAJ/

10:07 video runtime

First published at 00:50 UTC on December 26th, 2020.

channel image

beyondtheicea

beyondtheicea

1959 subscribers

TIFFANY PONTES DOVER FAINTS IN 17 MINS, DEAD IN 10 HOURS
https://www.bitchute.com/video/as1rvnNFNaQQ/
Sergeant Major
https://www.bitchute.com/channel/rzUd1ovwJXug/
SERGEANT MAJOR'S TRUTHER INFO

NURSE TIFFANY PONTES DOVER gets Pfizer mRNA Vaccine l…

Dachsie comment: Having strong second thoughts about this last video about Tiffany Dover being "proven" dead. Presentation was unprofessional and sketchy and did not prove anything. Should have been much more clear about showing connections and sites he draws his "proof" from. Looks like a sophisticated CIA DisInfo Trick on the gullible public. This guy's video will go viral and then someone will come along and handily show all that his whole video was a deception. Then the CIA realizes the general public person will come to the illogical conclusion ...--"News of Tiffany Dover being dead is a hoax so the vaccine is good and we should trust the hospital and medical people offering us the vaccine for our good.

monty
28th December 2020, 02:07 PM
There is no test, officially from Canadian gov’t.

https://i.postimg.cc/FsNrX7jW/7-C3-A0-F52-1-CA1-4452-B101-9021-EE3917-D1.png

Dachsie
29th December 2020, 05:55 AM
Heads Up Truth and Freedom and USA lovers !

Our local grocery stores, the places where we must procure our food, are now launching their big Satanic anti-Truth, anti-Christ, anti-Logos "covid" vaccine advertising campaign.

To obtain our food to live, we must subject ourselves to the soft-kill of the Satanic vaccine.

__________________________________________________ ____

https://www.randalls.com/pharmacy/covid-19/_jcr_content/root/responsivegrid/column_control_1016112139/par_1/column_control_34053_574457640/par_0/image.coreimg.jpeg/1608233089784.jpeg

Our local Texas grocery store chain, Randalls, is now offering

"COVID-19 Vaccine: Coming Soon
At Randalls, we are working hard to support your health. Our specially trained pharmacy teams have partnered with the CDC, state, and local health departments to provide COVID-19 vaccines to you and your loved ones, free of charge.*

Throughout this pandemic, our pharmacy teams have been on the front lines, offering care and health solutions for our communities. We will be ready and prepared to assist you in this important public health service.

While we wait for the vaccine, let’s remember to wash hands frequently, social distance, and wear masks."

Fight back by finding ways to get your food in ways and from places that do not force you to sacrifice your body and sell your soul to Satanic evil.

(It is no coincindence that Randalls is heavily affiliated with Startbucks Coffee shops and products. The vaccine and the coffee is laced with murdered human tissue.)


https://www.randalls.com/pharmacy/covid-19.html?deeplinkuid=cSLUyVc5aM3+sYnBMPRdQQ==&cmpid=em_ran_sou_cb__ahoc__20201229&HHID=200001307910&Theme=COVID19_Vaccine

PatColo
29th December 2020, 06:42 AM
Just now discovering this 12/23 POTUS re-twatt of an indy produced 8m vid:
https://twitter.com/realDonaldTrump/status/1341948764068704256

it's VG overall, slick production, gets the "long term commie infiltration" part right; but the rest of it is the kosher-MAGA song sheet, with "the virus which has crippled the world (hoax)" blamed squarely on MUH CHIY-NUH; meanwhile the global rothschild/JWO octopus, aka Trump's puppeteers, conspicuously absent from the vid. Note the "MUH CHICOMS OWN THE MEDIA & PEDOWOOD" bit...:rolleyes:

As far as I can tell, after the "(((Great Reset)))", & after the controlled demolition of USA underway now is 'complete', da dinjoo-nuffins have designated MUH CHIY-NUH to play the puppet role of USA since WW2, namely: world's sole superpower/villain (depending on who's being asked), concealing the true izzy/Jerusalem/dinjooz controlling MUH CHIY-NUH; same as they have USA through our ~75 years of superpower-dom.

related: muh latest meme, which I can paste directly into this thread, coz muh Dachsie smartly opened this thread in "News & current events" subforum, not GD:


https://i.imgur.com/LWRnq6i.png

woodman
29th December 2020, 06:49 AM
Just now discovering this 12/23 POTUS re-twatt of an indy produced 8m vid:
https://twitter.com/realDonaldTrump/status/1341948764068704256

it's VG overall, slick production, gets the "long term commie infiltration" part right; but the rest of it is the kosher-MAGA song sheet, with "the virus which has crippled the world (hoax)" blamed squarely on MUH CHIY-NUH; meanwhile the global rothschild/JWO octopus, aka Trump's puppeteers, conspicuously absent from the vid.

As far as I can tell, after the controlled demolition of USA underway now, da dinjoo-nuffins have designated MUH CHIY-NUH to play the role of USA since WW2, namely: world's sole superpower/villain (depending on who's being asked), concealing the true izzy/Jerusalem/dinjooz controlling MUH CHIY-NUH; same as they have through USA's ~75 years of superpower-dom.

related: muh latest meme, which I can paste directly into this thread, coz muh Dachsie smartly opened this thread in "News & current events" subforum, not GD:


https://i.imgur.com/LWRnq6i.png
You've hit the nail on the head Pat. China has been ramped up to take our place since Nixon went over there in the 70's. We are going full-on vassal state of Israel (not that we aren't already). I would love to see the detailed plans for the US and the rest of the West. I think they have been quite open about it though. We are going to be Kalergied. The real question is: Will we just roll over and let it happen?

Dachsie
29th December 2020, 07:43 AM
Just now discovering this 12/23 POTUS re-twatt of an indy produced 8m vid:
https://twitter.com/realDonaldTrump/status/1341948764068704256

it's VG overall, slick production, gets the "long term commie infiltration" part right; but the rest of it is the kosher-MAGA song sheet, with "the virus which has crippled the world (hoax)" blamed squarely on MUH CHIY-NUH; meanwhile the global rothschild/JWO octopus, aka Trump's puppeteers, conspicuously absent from the vid. Note the "MUH CHICOMS OWN THE MEDIA & PEDOWOOD" bit...:rolleyes:

As far as I can tell, after the "(((Great Reset)))", & after the controlled demolition of USA underway now is 'complete', da dinjoo-nuffins have designated MUH CHIY-NUH to play the puppet role of USA since WW2, namely: world's sole superpower/villain (depending on who's being asked), concealing the true izzy/Jerusalem/dinjooz controlling MUH CHIY-NUH; same as they have USA through our ~75 years of superpower-dom.

related: muh latest meme, which I can paste directly into this thread, coz muh Dachsie smartly opened this thread in "News & current events" subforum, not GD:


https://i.imgur.com/LWRnq6i.png

This meme is brilliant and just wonder if this is your personal creation, PatColo.

Dachsie
29th December 2020, 08:30 AM
https://img.ifunny.co/images/6c052b9b72bc59c7c3a4a21a42aa51ae41c569fad0c443c5e7 26692291b17517_1.jpg

Dachsie
29th December 2020, 08:37 AM
https://ifunny.co/fun/ersvrogF8?s=e

PatColo
29th December 2020, 10:52 AM
This meme is brilliant and just wonder if this is your personal creation, PatColo.

It's my mashup of Jeff Berwick / Dollar Vigilante's recent vid thumbnail, which this bitchute page will display:

ALERT: New Coronavirus Mutation as It Attains Its Final Form... Communism (https://www.bitchute.com/video/lw7BYqJYSsuF/)

I screencapped the thumbnail & took the basic idea in his title, & reworded it to my liking. MS Paint was my scalpel... :cool:

not sure if he (or his vid/graphics technical assistant) did the artwork of the MuhRONA (AKA JooFlu19) mutating; quite laborious if so -- whoever did it tho, kudos to them!
--H H--

PatColo
29th December 2020, 10:58 AM
Jeff B's 2 later vids after that ^ one (which was 12/23)

Dec 29, 2020
People Dropping Like Flies from the Vax, Empty Hospitals and Tik Tok Nurses (https://www.bitchute.com/video/CoJK5sgKCQVQ/)

Dec 26, 2020
A Merry Bitcoin Christmas and a Mass Genocide/Awakening New Year (https://www.bitchute.com/video/KhhbagqcJSPi/)

Dachsie
29th December 2020, 11:22 AM
It's my mashup of Jeff Berwick / Dollar Vigilante's recent vid thumbnail, which this bitchute page will display:

ALERT: New Coronavirus Mutation as It Attains Its Final Form... Communism (https://www.bitchute.com/video/lw7BYqJYSsuF/)

I screencapped the thumbnail & took the basic idea in his title, & reworded it to my liking. MS Paint was my scalpel... :cool:

not sure if he (or his vid/graphics technical assistant) did the artwork of the MuhRONA (AKA JooFlu19) mutating; quite laborious if so -- whoever did it tho, kudos to them!
--H H--

You have great CGI skills. Would like a shirt with that on it.

woodman
29th December 2020, 11:52 AM
https://ifunny.co/fun/ersvrogF8?s=e
Excellent stuff there!

PatColo
29th December 2020, 11:55 AM
You have great CGI skills. Would like a shirt with that on it.

"thanks", but seems u missed my message -- I didn't do the main "MuhRona mutating" artwork; just copied it & meme'd it up. Most credit goes to (whoever the orig artwork creator was), which reached me via Jeff Berwick's Dollar Vigilante bitchute ch: Dollar_Vigilante (https://www.bitchute.com/channel/dollar_vigilante/)

now watching his latest pub'd today; great compilation near the beginning documenting empty hospitals:
People Dropping Like Flies from the Vax, Empty Hospitals and Tik Tok Nurses (https://www.bitchute.com/video/CoJK5sgKCQVQ/)


edit: those on twatter (or even not) go to Dollar Vigilante's timeline (https://twitter.com/DollarVigilante) for several great short clips (to Like/RT) taken from today's full vid above -- sick of dancing tiktok nurses, empty hospitals in CALIF, Bells Palsy stricken nurse begs ppl NOT to take the 666Jab...

Dachsie
29th December 2020, 12:41 PM
I realized that but think most of us do not even have the considerable skills needed to ...

"" just copied it & meme'd it up"

Dachsie
29th December 2020, 01:40 PM
https://www.mostholyfamilymonastery.com/news/woman-says-reaches-a-breaking-point-with-the-covid-hoax/


https://twitter.com/i/status/1343266782463754240


https://twitter.com/i/status/1343266782463754240


2:16 video runtime



https://twitter.com/stillgray?ref_src=twsrc%5Etfw%7Ctwcamp%5Etweetembe d%7Ctwterm%5E1343266782463754240%7Ctwgr%5E%7Ctwcon %5Es1_&ref_url=https%3A%2F%2Fwww.mostholyfamilymonastery. com%2Fnews%2Fwoman-says-reaches-a-breaking-point-with-the-covid-hoax%2F





Woman Says She Has Reached A Breaking Point With The Covid Hoax- video


Ian Miles Cheong
@stillgray
I completely agree with this woman. Do you have the courage to be like her?

Dachsie
30th December 2020, 09:40 AM
https://cldup.com/q9OwZiomVG.mp3

55 minute audio

Part of this show deals with evil games being played in relation to totalitarian command of people to take the carona-Killer vaccine.



ACH (1418) Mischa Popoff – Hobgoblins
by achitchcock

https://ecp.yusercontent.com/mail?url=https%3A%2F%2Fandrewcarringtonhitchcock.c om%2Fwp-content%2Fuploads%2F2020%2F12%2FHobgoblins.jpg&t=1609344157&ymreqid=cfc662b2-355b-9549-1c9c-9202e7011700&sig=PaxuKCmdXv..ZOp8grySog--~D

In today’s show originally broadcast on December 30 2020, Andy is joined by Mischa Popoff, for a show entitled, “Hobgoblins.”

We discussed: the background of H.L. Mencken; what Tesla said about Einstein; the persecution of Joseph McCarthy;

the CDC report that revealed just over 3% of people who have received the Covid-19 vaccine have had an adverse reaction to it; how the vaccine is just the beginning as you will need follow up booster shots every 3-12 months; how the UK is continuing to claim the vaccine is safe whilst using an EU procurement agency to source an artificial intelligence tool to process the expected high volume of Covid-19 vaccine adverse drug reactions; why won't Pfizer release the list of ingredients in their Covid-19 vaccine; how Spain are building up a database of all their people who refuse to take the Covid-19 vaccine;


the importance of getting a Faraday Cage for your cellphone, as your phone is tracking you even when it is switched off; and many other topics.

Click Here To Listen To The Show

Click Here For The CDC Presentation That We Referenced On The Show - See The Table At The Top Of Page 6

Click Here For Proof That The British Government Are Expecting A HIGH VOLUME OF ADVERSE REACTIONS TO THE COVID-19 VACCINE. Scroll Down To Point II.1.4 On This European Union Website

Click Here For Details Of Mischa's Book "Is It Organic?

____________

Dachsie Comment:

I heard someone on a show recently say he calculated the number of people who are expected to have a Covid-19 vaccine adverse drug reaction in the UK (only) at a rate of like 2.9% and it was a number over one million people.

We will probably not have any true investigative journalist get good follow-up reporting on the Chatanooga TN nurse, Tiffany Dover, who has not been seen or heard from since she fainted on live TV after taking the vaccine. But her "side effect" could be of a various serious kind involving permanent neurological injury and even death.

The vaccine is designed to operate on the immune system and likelihood of symptoms of extreme inflammation will ensue with every recipient. That is a crap shoot that could mean very serious impact on the recipient in the short term as well as for the rest of their life.

Catherine Austin Fitts mentioned on her recent visit to Greg Hunter show that there is an Italian research study that focuses on the ingredients of the several Covid 19 vaccines that are about to released to, or released on the public. I have made efforts to find that study and a link to it but no luck yet.

I am no longer interested in trying to convince people to avoid the vaccine like the plaque because those people are unreachable and their critical thinking abilities are impervious to facts and logical reasoning.

Everything about this who SCAMdemic, PLANdemic has been one Satanic lie upon another and same goes for the savior vaccines. The plan is to install a

One World Death and Slavery System for All.

Dachsie
30th December 2020, 10:40 AM
Here is the free downloadable pdf CDC report referenced in the Andrew Carrington Hitchcock show with Mischa Popoff.

https://www.cdc.gov/vaccines/acip/meetings/downloads/slides-2020-12/slides-12-19/05-COVID-CLARK.pdf (I did post this CDC recently in this thread.)

December 18, 2020 is the date the CDC published this CYA report. The "health impact events" were already piling up.


Anaphylaxis in UK Following COVID-19 Vaccination

Anaphylaxis Following m-RNA COVID-19 Vaccine ReceiptThomas Clark, MD, MPHDecember 19, 2020

December 8, 2020 – UK initiated vaccination with Pfizer-BioNTechCOVID-19 vaccine

December 9 –UK authorities confirmed 2 cases of anaphylaxis after vaccination

Prescribing information for both Pfizer-BioNTechand ModernaCOVID-19 vaccines contains information on anaphylaxis–Severe allergic reaction (e.g., anaphylaxis) to any component of the vaccine is a contraindication to vaccination–Appropriate medical treatment used to manage immediate allergic reactions must be immediately available in the event an acute anaphylactic reaction occurs following administration of the vaccine

Health Impact Event definition in CDC report

*Dec 18, 5:30 pm EST**unable to perform normal daily activities, unable to work, required care from doctor or health care professional"

Dachsie
30th December 2020, 10:54 AM
Heads Up Truth and Freedom and USA lovers !

Our local grocery stores, the places where we must procure our food, are now launching their big Satanic anti-Truth, anti-Christ, anti-Logos "covid" vaccine advertising campaign.

To obtain our food to live, we must subject ourselves to the soft-kill of the Satanic vaccine.

__________________________________________________ ____

https://www.randalls.com/pharmacy/covid-19/_jcr_content/root/responsivegrid/column_control_1016112139/par_1/column_control_34053_574457640/par_0/image.coreimg.jpeg/1608233089784.jpeg

Our local Texas grocery store chain, Randalls, is now offering

"COVID-19 Vaccine: Coming Soon
At Randalls, we are working hard to support your health. Our specially trained pharmacy teams have partnered with the CDC, state, and local health departments to provide COVID-19 vaccines to you and your loved ones, free of charge.*

Throughout this pandemic, our pharmacy teams have been on the front lines, offering care and health solutions for our communities. We will be ready and prepared to assist you in this important public health service.

While we wait for the vaccine, let’s remember to wash hands frequently, social distance, and wear masks."

Fight back by finding ways to get your food in ways and from places that do not force you to sacrifice your body and sell your soul to Satanic evil.

(It is no coincindence that Randalls is heavily affiliated with Startbucks Coffee shops and products. The vaccine and the coffee is laced with murdered human tissue.)


https://www.randalls.com/pharmacy/covid-19.html?deeplinkuid=cSLUyVc5aM3+sYnBMPRdQQ==&cmpid=em_ran_sou_cb__ahoc__20201229&HHID=200001307910&Theme=COVID19_Vaccine





______

Deborah Tavares did a presentation telling about Starbucks coffee alleged to contain human tissue.

There have been several stories about an ingredient in the new Covid vaccines contain cell lines, DNA / RNA of aborted fetus.

Interesting bible verses.

Leviticus 26:29

[29] So that you shall eat the flesh of your sons and of your daughters.


Ezekiel 5:10

[10] Therefore the fathers shall eat the sons in the midst of thee, and the sons shall eat their fathers: and I will execute judgments in thee, and I will scatter thy whole remnant into every wind.

Dachsie
31st December 2020, 06:09 AM
China Admits Wuhan Cases Far Higher than Prior, as New Strain Hits California and China

https://static-3.bitchute.com/live/cover_images/Styxhexenham/XF-P225LzYE_320x180.jpg

This commentary of Styxhexenhammer666 is rather bombshell. It seems to contradict other articles and commentary I have heretofore accepted as true. Guess I need some other experts to chime in on this. (I have a basic skepticism of all of the information we are fed about this "virus". Styx assumes certain characteristics of his foundational acceptance of what he refers to as "evolution" based on his atheist or agnostic (occultist - satanist ?) worldview, and do not find the level of ethical neutrality of true science in his take on new information coming to us .) True it is that we can trust information coming from the CCP - Chi Coms as much as we can trust USA mainstream media and the US Congress, possibly all one and the same.




https://www.bitchute.com/video/XF-P225LzYE/

Dachsie
31st December 2020, 06:51 AM
From Magic Virus to Transhumanism Technocracy

Catherine Austin Fitts

Planet Lockdown | Catherine Austin Fitts | Full Interview

48:31 video runtime

https://www.bitchute.com/video/J7HlnLTdCvWf/

First published at 12:45 UTC on December 31st, 2020.

https://static-3.bitchute.com/live/cover_images/Rbtrop3rRlZl/J7HlnLTdCvWf_640x360.jpg

channel image

Jim Fetzer

Jim Fetzer

2337 subscribers

REQUIRED VIEWING!!! This is the great Catherine Austin Fitts removing the curtain and showing us what the real agenda is behind the CV19 pandemic. It is THE BEST explanation of the REAL machinations behind the pandemic that has been given to date!
This sit down interview with Catherine covers the spectrum of the current situation we find ourselves in.
It was conducted as a part of the full length documentary. We are releasing the full interview for the betterment of public understanding of the situation.

Mirrored from: https://www.youtube.com/watch?v=C1-0XKYAZII&feature=emb_imp_woyt
LESS
Category News & Politics
Sensitivity Normal - Content that is suitable for ages 16 and over

Dachsie
1st January 2021, 06:55 AM
"MURDER she wrote"



"while undergoing treatment to fight the virus"


"procedure related to the infection"

Republican Louisiana Congressman-elect Luke Letlow, 41, has died just eleven days after announcing he had coronavirus. He died from a heart attack following a procedure related to the infection

Louisiana Republican House Representative-elect, Luke Letlow, who died while battling COVID-19, suffered a heart attack while undergoing treatment to fight the virus, a hospital official has revealed.

https://www.dailymail.co.uk/news/article-9097681/amp/Republican-Louisiana-Congressman-elect-Luke-Letlow-41-dies-COVID-19-10-days-positive.html

https://i.dailymail.co.uk/1s/2020/12/30/16/37415154-0-image-a-76_1609345245315.jpg





Luke Letlow, 41, told constituents on December 18 that he had COVID-19

He was taken to the hospital on December 19 and was moved to the ICU

The father-of-two was treated with Remdesivir and a combination of steroids

Doctors have revealed he suffered a heart attack during an operation

Letlow had no underlying health conditions, doctors said Tuesday

He had held a number of campaign events - some with masks, some without
Letlow, a Republican, won a runoff election on December 5 for the 5th District seat, which represents Northeast and Central Louisiana

He was due to be sworn in on Sunday and is the first member or member-elect of Congress to die from the coronavirus

Letlow is one of more than 7,000 people in Louisiana who have died from COVID-19 since March, according to data from the state health department

Dachsie
1st January 2021, 04:56 PM
CDC map says seasonal flu is all gone this year. This year everything is "COVID-19"

https://www.cdc.gov/flu/weekly/usmap.htm

See one minute video by Owen Shroyer here...

https://www.mostholyfamilymonastery.com/news/cdc-says-flu-is-gone-its-all-covid-19/

was not able to find link to previous year CDC map showing very high flu rates all over the US

Dachsie
2nd January 2021, 07:49 AM
Sorry Dr. Erickson and Mr Levin, but you have designed and participated in a deceptive and manipulative gaslighting theatrical production based on all the ambiguous and fallacious assumptions and premises. If Dr. Erickson were telling the whole truth, he would be unemployed. If Mr. Levin were telling the truth, he would stop pushing the Left / Right paradigm and he would be kicked off YouTube.

You have never medically and scientifically identified "the disease" and you use a "test" that was never intended to "diagnose" any disease. SARScov2 has never been scientifically isolated. We have no clear definition of "COVID-19" just as we will have no clear definition of the emerging "highly infectious CCP virus variant" that has arrived in Ontario Canada and California. More lockdowns coming soon.
_________________


https://www.youtube.com/watch?v=OY4xSz6yCMk

...https://www.youtube.com/watch?v=OY4xSz6yCMk...

3:53 video runtime

ER Doctors Reveal Disturbing COVID Truths Media Won’t Tell You | LevinTV
2,444,974 views
•Apr 28, 2020
86K
2.4K
Share
Save
BlazeTV
1.33M subscribers
Mark Levin reacts to a viral video of ER doctors revealing disturbing facts about COVID-19. WATCH more Mark Levin: https://blazetv.com/levin

► Click HERE to subscribe to BlazeTV on Youtube! https://bit.ly/2KJHuwu

Dachsie
6th January 2021, 04:08 AM
https://static-3.bitchute.com/live/cover_images/Rbtrop3rRlZl/PyaQMEI6doIX_640x360.jpg

https://www.bitchute.com/video/PyaQMEI6doIX/


14:32 video runtime

First published at 04:19 UTC on January 6th, 2021.

channel image

Jim Fetzer

Jim Fetzer

2542 subscribers

Dr. Vernon Coleman makes a brilliant and courageous impassioned statement about the tyranny descending upon us and what it will take to stop it.

Mirrored from: https://brandnewtube.com/watch/make-no-mistake-this-is-genocide_kJBRkPY1j7MupJl.html

_________________
free pdf download of Dr. Coleman's book

https://thelightpaper.co.uk/assets/pdf/vc-moreharmthangood.pdf

Proof That Face Masks DoMore Harm Than Good

Proof That Face Masks DoMore Harm Than GoodDr Vernon Coleman MB ChB DSc FRSASunday Times Bestselling Author

_

https://thelightpaper.co.uk/assets/pdf/dr-vernon-coleman-covid-greatest-hoax.pdf

Covid-19The Greatest Hoax in History

Covid-19The Greatest Hoax in HistoryDr Vernon Coleman
Covid-19: The Greatest Hoax in HistoryThe startling truth behind the planned world takeoverThe scripts of Vernon Coleman’s ‘Old Man in a Chair’ videos for YouTubetogether with articles from vernoncoleman.com

PatColo
6th January 2021, 08:52 AM
New Max & his various poultry dishes, 45m:

Jan 05, 2021
The Mainstream Media's War on Truth and Freedom (https://www.bitchute.com/video/PBSavbpfU8uG/)

Dachsie
6th January 2021, 09:14 AM
New Max & his various poultry dishes, 45m:

Jan 05, 2021
The Mainstream Media's War on Truth and Freedom (https://www.bitchute.com/video/PBSavbpfU8uG/)


deblasio with dwarf wife wearing pedophile mask

https://external-content.duckduckgo.com/iu/?u=https%3A%2F%2Fi2.wp.com%2Fwww.secondamendmentda ily.com%2Fwp-content%2Fuploads%2F2021%2F01%2FScreenshot_2021-01-01-2Q7C4LFTNFF73AVFA4PDG6V2JM-jpg-JPEG-Image-1400-%25C3%2597-1006-pixels-%25E2%2580%2594-Scaled-721-e1609606550178.jpg%3Fresize%3D840%252C480%26ssl%3D 1&f=1&nofb=1

...https://external-content.duckduckgo.com/iu/?u=https%3A%2F%2Fi2.wp.com%2Fwww.secondamendmentda ily.com%2Fwp-content%2Fuploads%2F2021%2F01%2FScreenshot_2021-01-01-2Q7C4LFTNFF73AVFA4PDG6V2JM-jpg-JPEG-Image-1400-%25C3%2597-1006-pixels-%25E2%2580%2594-Scaled-721-e1609606550178.jpg%3Fresize%3D840%252C480%26ssl%3D 1&f=1&nofb=1...

PatColo
6th January 2021, 11:42 AM
^

Story from Apr 2016, six mos before Pizzagate/Pedogate even emerged:

Mayor de Blasio reads ‘Secret Pizza Party’ to Queens kids — and the plot mirrors the fund-raising probe he’s caught up in
www.nydailynews.com/news/politics/de-blasio-reads-book-kids-mirrors-fund-raising-probe-article-1.2620104 (http://www.nydailynews.com/news/politics/de-blasio-reads-book-kids-mirrors-fund-raising-probe-article-1.2620104)

Dachsie
7th January 2021, 02:45 PM
https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-january-7-2021

The Corona Report 04:25 to 10:40


15"46 video total runtime

TruNews Headlines with Kerry Kinsey - January 7, 2021

Where’s the outrage for the Air Force veteran who was and shot killed Wednesday at the U.S. Capitol, new videos capture the disturbing death of Ashli Babbitt, Dr. David Martin says when you get the Covid vaccine;" You are injecting a chemical substance to induce illness,’ the inventor of the PCR test, the late Dr. Kary Mullis hammers Dr. Anthony Fauci’s lack of knowledge, on "Corona Crazy,’ it’s a Covid Crazy Canadian Crackdown, and with prompting from Jesus Christ find out how Kerry and Angela Kinsey helped save a TruNews viewer from taking his life.
Content Contributed By — TruNews Team

PatColo
9th January 2021, 04:56 AM
from a diff thread,


fwiw twatter banned my arse today too. it's fine, WOT anyways... they've had me shadowbanned there since shortly after I opened that acct in summer 2018 - I had workarounds but wtf, they're dishonest in how they try to quarantine ppl in their ideological bubbles, most of ur followers be damned

Early Fri AM I updated my twatter 'banner' image - that's the image which appears @ top of ppl's home/timeline page, in addition to whatever "profile image" they want, either their real pic or donald duck or potted plant or whatever, which appears in a circular frame partially covering your banner. 1 pic = 1K words, see (for example): https://twitter.com/DrMadej

So I updated my banner, which you'll notice purposely shifts the bottom "TOWARD ITS FINAL FORM" to the right, so that it's unobscured by the circular profile pic: http://imageupper.com/s12/1/9/U16101914031593286_1.png


http://imageupper.com/s12/1/9/U16101914031593286_1.png


I hope you'll agree, my addition of the kosher symbol vs the earlier version, is a nice touch! :D

It's also scaled 3 x 1 which is the ratio twatter forces you to have, or else select from your image of choice; so this will fit perfectly as-is.

I say all this blah blah, to invite anyone here with a twatter account & who survives this massacre, to grab the above banner & make it your own @ twatter.

Unclear if the above 'triggered' my perma ban yest - like I said above, I was already tagged a bad boy there since, surely hours or few days of opening that acct. They've also "Locked" my acct like 5x in its 2.5 year life, requiring code sent to my (burner/anon) phone, which I needed to enter to unlock acct.

But yest (to be ongoing?) was also their big massacre day, so I lean towards thinking the new/improved banner image above was just coincidence. So just be conscious of that if u choose to upgrade whatever inferior twatter banner you have now with the above - be prepped if they suddenly pull the plug on you. :)

PatColo
9th January 2021, 06:01 AM
Fantastic show here; Dr Judy has toned down the hard bioscience talk & this is more layman level, including of course plenty of excellent analysis of this week's staged events.

2h 7m - start @ 6m to skip a bunch of nonsense:

The Perfect Triangle Episode 26 Dr Judy Mikovits - 08 January 2020 (https://www.youtube.com/watch?v=RTm7WvWGisE)


https://www.youtube.com/watch?v=RTm7WvWGisE

Dachsie
9th January 2021, 09:22 AM
Very important video.

We all need to use our own situation and state in life and our God-given abilities to promote TRUTH. That is the Truth THEOweapon.

Pray unceasingly. God will help you in just the right way at just the right time. Love Him and he will continually help you every step of your way in this valley of tears.

PatColo
10th January 2021, 03:37 AM
latest from Max, a shorty at only 22m, & main payload wrt the title is presented @ 6m thru 9m; before & after that it's misc musings & gov/police tyranny outrage clips.

THE COMING ZOMBIE APOCALYPSE (https://www.bitchute.com/video/5z8bilOTBgAT/)

mainly makes the point, which I've heard elsewhere, the TESTS could be damaging the blood/brain barrier allowing bacteria into the the brain, triggering some form of encephalitis to set in, leading to "zombieism" which the satanists will try to spin as, "the MuhRONA can damage the brain", which they'll then likely try to take so far as fabricating how "asymptomatic spreaders can still be affected by dementia/delusions", in describing perfectly healthy ppl who're righteously skeptical of the muhRONA hoax.

^ all 'wild eyed speculation' ^ aside, Max raises the question, why does CDC have this page/article on their site?!?!?

Zombie Preparedness | CDC (https://www.cdc.gov/cpr/zombie/index.htm)
https://www.cdc.gov/cpr/zombie/index.htm (https://www.cdc.gov/cpr/zombie/index.htm)

Dachsie
10th January 2021, 04:42 AM
The twisting of the thinking of half the population of the USA has been going on for at least 70 years. Destruction of Western civilization is just about complete. It started with socialism and now is full blown communism. Half the population has a completely twisted perception of reality and zero logical reasoning and critical thinking. I do not believe in "waking anybody up". You cannot reach them with truth. They have full herd immunity to truth.

Every thinking person has every reason not to trust anything coming out by the government and the medical establishment about this woo flu scam. This whole thing has been a psy op and lie upon lie from the beginning. Not scientific and either no data or twisted lie data. They are ramping it up and will be coming out with new strains and more draconian regulations.

Any temporary reprieve by Trump taking another term will happen only because of prayer and an act of God which will look very much like a miracle to most of us.

Now is the time for sly strategic civil disobedience. Communism / Marxism killed a hundred million people in the twentieth century and is still going strong.

Dachsie
10th January 2021, 01:20 PM
Green Zone
Communist style Concentration Camp
THEY will sort the apprehended as to who is able to work and who is useless to them so think Communist GENOCIDE

https://www.cdc.gov/coronavirus/2019-ncov/global-covid-19/shielding-approach-humanitarian.html


Interim Operational Considerations for Implementing the Shielding Approach to Prevent COVID-19 Infections in Humanitarian Settings
Updated July 26, 2020

This document presents considerations from the perspective of the U.S. Centers for Disease Control & Prevention (CDC) for implementing the shielding approach in humanitarian settings as outlined in guidance documents focused on camps, displaced populations and low-resource settings.1,2 This approach has never been documented and has raised questions and concerns among humanitarian partners who support response activities in these settings. The purpose of this document is to highlight potential implementation challenges of the shielding approach from CDC’s perspective and guide thinking around implementation in the absence of empirical data. Considerations are based on current evidence known about the transmission and severity of coronavirus disease 2019 (COVID-19) and may need to be revised as more information becomes available. Please check the CDC website periodically for updates.
What is the Shielding Approach1?

The shielding approach aims to reduce the number of severe COVID-19 cases by limiting contact between individuals at higher risk of developing severe disease (“high-risk”) and the general population (“low-risk”). High-risk individuals would be temporarily relocated to safe or “green zones” established at the household, neighborhood, camp/sector or community level depending on the context and setting.1,2 They would have minimal contact with family members and other low-risk residents.

Current evidence indicates that older adults and people of any age who have serious underlying medical conditions are at higher risk for severe illness from COVID-19.3 In most humanitarian settings, older population groups make up a small percentage of the total population.4,5 For this reason, the shielding approach suggests physically separating high-risk individuals from the general population to prioritize the use of the limited available resources and avoid implementing long-term containment measures among the general population.

In theory, shielding may serve its objective to protect high-risk populations from disease and death. However, implementation of the approach necessitates strict adherence1,6,7, to protocol. Inadvertent introduction of the virus into a green zone may result in rapid transmission among the most vulnerable populations the approach is trying to protect.

A summary of the shielding approach described by Favas is shown in Table 1. See Guidance for the prevention of COVID-19 infections among high-risk individuals in low-resource, displaced and camp and camp-like settings 1,2 for full details.

Table 1: Summary of the Shielding Approach1

Level

Movement/ Interactions

Household (HH) Level:

A specific room/area designated for high-risk individuals who are physically isolated from other HH members.

Low-risk HH members should not enter the green zone. If entry is necessary, it should be done only by healthy individuals after washing hands and using face coverings. Interactions should be at a safe distance (approx. 2 meters). Minimum movement of high-risk individuals outside the green zone. Low-risk HH members continue to follow social distancing and hygiene practices outside the house.

Neighborhood Level:

A designated shelter/group of shelters (max 5-10 households), within a small camp or area where high-risk members are grouped together. Neighbors “swap” households to accommodate high-risk individuals.

Same as above

Camp/Sector Level:

A group of shelters such as schools, community buildings within a camp/sector (max 50 high-risk individuals per single green zone) where high-risk individuals are physically isolated together.

One entry point is used for exchange of food, supplies, etc. A meeting area is used for residents and visitors to interact while practicing physical distancing (2 meters). No movement into or outside the green zone.

Operational Considerations

The shielding approach requires several prerequisites for effective implementation. Several are addressed, including access to healthcare and provision of food. However, there are several prerequisites which require additional considerations. Table 2 presents the prerequisites or suggestions as stated in the shielding guidance document (column 1) and CDC presents additional questions and considerations alongside these prerequisites (column 2).

Table 2: Suggested Prerequisites per the shielding documents and CDC’s Operational Considerations for Implementation " SNIP

__________________________________

Also see audio file

https://rumble.com/vclugx-thrivetime-show-fireside-chat-7-lin-wood-are-americans-reaching-their-boili.html?mref=6zof&mrefc=2

Lin Wood Fireside Chat Number 7

Deep state filth may have big things planned for Monday, January 11, 2021.

Child worldwide trafficking and pedophilia is the real PANDEMIC.

Dachsie
10th January 2021, 01:52 PM
https://www.thrivetimeshow.com/business-podcasts/fireside-chat-7-lin-wood-why-is-the-cdc-calling-for-nazi-style-concentration-camps-what-is-inside-hunter-bidens-laptop-are-americans-reaching-their-personal-boiling-points-when-are-we/

These notes go with Lin Wood Fireside Chat Number 7

Show Notes

Attorney Lin Wood shares what is inside Hunter Biden’s laptop while asking why the CDC is Calling for Nazi-Style concentration camps and what is your personal boiling point? Lin Wood also shares why believes that it is 1776 all over again.

Lin, We Now Have 100% Irrefutable Evidence That:

The Models Used to Justify the Lockdowns Were Nefariously FALSE https://timetofreeamerica.com/#Models-section
The PCR / COVID-19 Tests Used to Justify the Mask Mandates and Restrictions Are Intentionally FALSELY Calibrated
WATCH – https://thehighwire.com/videos/covid-testing-fraud-uncovered/
WATCH – The Founder of the PCR Kary Mullis Shares – “Tony Fauci doesn’t mind going in front of TV and lying on camera. He doesn’t understand medicine and he shouldn’t be in the position that he is in.” – Kary Mullis (The founder of the PC test) – https://www.bitchute.com/video/55LBX7rj94eZ/
Wearing a Mask Makes Healthy People Sick
COVID-19 is 100% Treatable When Budesonide or Ivermectin is Used and Wearing a Mask is Bad for Your Health:
“If you take ivermectin for COVID-19 you will not get sick.” | 100% Effective COVID-19 Treatments – https://www.bitchute.com/video/OzrAVkI3nLIf/
Doctor Richard Bartlett (MD) Has Successfully Treated 1,000+ COVID-19 Patients with 0 Deaths
1. Watch His Newsmax Interview: https://www.bitchute.com/video/seKCo8Nx9fEr/
2. Read His Case Study – http://budesonideworks.com
Wearing a Mask Is Bad for Your Health – https://timetofreeamerica.com/#Masks-section
Forced Isolation / Nazi-Style Concentration Camps – https://www.cdc.gov/coronavirus/2019-ncov/global-covid-19/shielding-approach-humanitarian.html?fbclid=IwAR16k-HIzASknx8jx49JOhD8Vrrt5E30-g2ipsy19nfSDficm3NFTNf6YmM



Yet, we still are having lockdowns, mask mandates and the American people are being denied proven and safe treatments like Budesonide and Ivermectin, what is going on?

Lin, we now have 100% irrefutable evidence of medical fraud and we now have 100% irrefutable evidence of election fraud including:

Step 1 – America used the Canadian-owned DOMINION vote counting machines using Chinese parts in 28 states

The Former CEO of Overstock.com Explains the Technology That Was Used to Rig the 2020 Elections
https://www.deepcapture.com/2020/11/election-2020-was-rigged-the-evidence/
Communist Chinese Gov’t-Linked Bank Account Gave $400M To Dominion Voting Systems Before US Election – http://www.christianitydaily.com/articles/10232/20201203/communist-chinese-gov-t-linked-bank-account-gave-400m-to-dominion-voting-systems-before-us-election.htm



Step 2 – The Canadian-owned DOMINION hardware gets its software from Sequoia Voting Systems (Formerly known as SMARTMATIC which is a Delaware company owned by Venezuelans close to the Communist Venezuelan Chavez and Maduro family)



Step 3 – Then our United States votes were stored on a server in Frankfurt Germany.

Trump recount committee has seen raw data from seized Dominion servers of how VOTES WERE SWITCHED by an algorithm in the software!!! “The things that are going to come out are going to SHAKE the globalists to their very core” – https://twitter.com/Bls1022/status/1328833128652296195?s=20
BREAKING EXCLUSIVE: WE GOT IT! — Col. Waldron Confirms US Has a Copy of the Election Night Data ‘Traffic and Packets’ Sent Overseas to Frankfurt! (VIDEO) – https://www.thegatewaypundit.com/2020/12/breaking-exclusive-got-col-waldron-confirms-us-copy-election-night-data-traffic-packets-sent-overseas-frankfurt-video/



Step 4 – Then our votes actually get counted in Barcelona, Spain and Smartmatic has a special software feature that allows users to change votes

Their software allows them to change the VOTE
Oh…and Smartmatic Owns DOMINION
Listen to Rudy Giuliani and Jenna Ellis on the Dan Bongino Show https://youtu.be/PSCik12dpTo?t=3647



Lin, we now have 100% irrefutable evidence of medical fraud and we now have 100% irrefutable evidence of election fraud and yet, the state courts and the Supreme Court refuses to look at the evidence, what is really going on?

Lin, you, Sidney Powell and countless attorneys were banned from Twitter today, yet Antifa members are still allowed to freely post, what is going on?

Lin, on Parler, you have been posting out screenshots from Hunter Biden? Sir what is on his laptop and how did you get a hold of it?

Lin, what is going on with the CDC recommending Forced Isolation / Nazi-Style Concentration Camps?

https://www.cdc.gov/coronavirus/2019-ncov/global-covid-19/shielding-approach-humanitarian.html?fbclid=IwAR16k-HIzASknx8jx49JOhD8Vrrt5E30-g2ipsy19nfSDficm3NFTNf6YmM



Lin, we all have our limit. I know for me, if I lock myself inside a chicken coup I’m going to freak out in about 30 seconds…and if you are using your phone while I’m watching a movie with you in the theatre, I’m going to freak out…however, what do you believe is the point that most Americans are simply not going to take the mask mandates, the business killing lockdowns, the shuttering of the schools and the nonsensical health guidelines anymore?



The Declaration of Independence:

The unanimous Declaration of the thirteen united States of America, When in the Course of human events, it becomes necessary for one people to dissolve the political bands which have connected them with another, and to assume among the powers of the earth, the separate and equal station to which the Laws of Nature and of Nature’s God entitle them, a decent respect to the opinions of mankind requires that they should declare the causes which impel them to the separation.

We hold these truths to be self-evident, that all men are created equal, that they are endowed by their Creator with certain unalienable Rights, that among these are Life, Liberty and the pursuit of Happiness.–That to secure these rights, Governments are instituted among Men, deriving their just powers from the consent of the governed, –That whenever any Form of Government becomes destructive of these ends, it is the Right of the People to alter or to abolish it, and to institute new Government, laying its foundation on such principles and organizing its powers in such form, as to them shall seem most likely to effect their Safety and Happiness. Prudence, indeed, will dictate that Governments long established should not be changed for light and transient causes; and accordingly all experience hath shewn, that mankind are more disposed to suffer, while evils are sufferable, than to right themselves by abolishing the forms to which they are accustomed. But when a long train of abuses and usurpations, pursuing invariably the same Object evinces a design to reduce them under absolute Despotism, it is their right, it is their duty, to throw off such Government, and to provide new Guards for their future security.–Such has been the patient sufferance of these Colonies; and such is now the necessity which constrains them to alter their former Systems of Government. The history of the present King of Great Britain is a history of repeated injuries and usurpations, all having in direct object the establishment of an absolute Tyranny over these States. To prove this, let Facts be submitted to a candid world.



Matthew 10:34-36 –

34 Think not that I am come to send peace on earth: I came not to send peace, but a sword.

35 For I am come to set a man at variance against his father, and the daughter against her mother, and the daughter in law against her mother in law.

36 And a man’s foes shall be they of his own household.



Listen now on Rumble.com, we just got kicked off of YouTube.com

https://rumble.com/vcjiy9-lin-wood-fireside-chat-6-why-vp-mike-pence-didnt-stand-up-for-the-president.html

Get all of the COVID-19 / 2020 Chaos Facts All In One Place At:
www.TimeToFreeAmerica.com

Download Sidney Powell’s 270 Page Report Showcasing 100% Irrefutable Evidence of 2020 Election Fraud:

https://www.zenger.news/sidney-powell-document-binder-2020-election-fraud/

Get Access to the 100% Effective and Proven COVID-19 Treatments and to Doctors Willing to Prescribe the Treatments:

www.BudesonideWorks.com

https://www.bitchute.com/video/OzrAVkI3nLIf/

Watch the Bush Family, the Obama Family, the Pence Family, and the Biden Family React to Opening the Envelopes at President George H. W. Bush’s Funeral:

https://youtu.be/oY5AvyayUw4?t=38

What Really Happened w/ the Nashville, TN Explosion?:

https://youtu.be/m4s_MwSVwWQ?t=1300

Don’t Miss A Bomb-Shell Dropping Podcasts Featuring Lin Wood, Patrick Byrne, Ann Vandersteel, Roger Stone, etc.)

https://www.thrivetimeshow.com/business-coach-podcast/

What is in the COVID-19 Vaccines?

https://www.thrivetimeshow.com/business-podcasts/dr-christiane-northrup-whats-inside-the-covid-19-vaccines/

Watch Clay Clark’s Recent Bombshell-Dropping Interview with Pastor David Scarlett:

https://www.youtube.com/watch?v=7JWoPTuRZSc

Proof Italian Interference in the United State Elections:

https://rumble.com/vchyn1-italian-job-and-americas-elections-yuge-day-people-and-pence-georgia-senate.html

The CDC Now Recommends Forced Isolation / Nazi-Style Concentration Camps – https://www.cdc.gov/coronavirus/2019-ncov/global-covid-19/shielding-approach-humanitarian.html?fbclid=IwAR16k-HIzASknx8jx49JOhD8Vrrt5E30-g2ipsy19nfSDficm3NFTNf6YmM



View the Kim Clement Prophecies – https://m.youtube.com/watch?v=Fh2hfbcPjOw&feature=youtu.be



Why Masks Make Healthy People Sick – Dr. Jim Meehan

https://meehanmd.com/blog/post/173679/an-evidence-based-scientific-analysis-of-why-masks-are-ineffective-unnecessary-and-harmful



The Truth About the Case-Inflating and Falsely Calibrated COVID-19 / PCR Tests?

Watch at 11 Minutes and 30 seconds – https://thehighwire.com/videos/covid-testing-fraud-uncovered/



President Trump Signed – Executive Order on Imposing Certain Sanctions in the Event of Foreign Interference in a United States Election – https://www.whitehouse.gov/presidential-actions/executive-order-imposing-certain-sanctions-event-foreign-interference-united-states-election/



Justice Department Allows Use of Firing Squads https://www.cnn.com/2020/11/27/politics/federal-execution-new-rule-firing-squads/index.html



September 12th 2018 – President Trump Signed – Executive Order on Imposing Certain Sanctions in the Event of Foreign Interference in a United States Election – https://www.whitehouse.gov/presidential-actions/executive-order-imposing-certain-sanctions-event-foreign-interference-united-states-election/
May 26 2020 – Director of National Intelligence – John Ratcliffe was sworn in as (DNI)
November 9th 2020 – Secretary of Defense – Christopher C. Miller Acting since November 9, 2020
November 10th 2020 – Ezra Asa Cohen-Watnick is the current Acting Under Secretary of Defense for Intelligence. He previously served as the Acting Assistant Secretary of Defense for Special Operations and Low-Intensity. – https://www.defense.gov/Our-Story/Biographies/Biography/Article/2297081/ezra-cohen/
November 29th 2020 – Justice Department rushing to expand execution methods like firing squads for federal death row inmates – https://www.cnn.com/2020/11/27/politics/federal-execution-new-rule-firing-squads/index.html
December 15th 2020 – FBI, US Marshals and Texas Rangers raid SolarWinds headquarters in Austin Texas! – https://www.sgtreport.com/2020/12/breaking-report-solarwinds-hq-raided-in-austin-more-news-coming-on-ceo-and-executive-vice-president-update/
U.S. Special Forces Raid Amazon Servers in Frankfurt Germany
December 31st – President Trump Funds the FEMA Camps – https://www.whitehouse.gov/presidential-actions/executive-order-adjustments-certain-rates-pay-010121/



Hebrews 10:25

“25 Not forsaking the assembling of ourselves together, as the manner of some is; but exhorting one another: and so much the more, as ye see the day approaching.”

Matthew 5:11

“11 Blessed are ye, when men shall revile you, and persecute you, and shall say all manner of evil against you falsely, for my sake.”



The Unity Prayer:

My adorable Jesus,
May our feet journey together.
May our hands gather in unity.
May our hearts beat in unison.
May our souls be in harmony.
May our thoughts be as one.
May our ears listen to the silence together.
May our glances profoundly penetrate each other.
May our lips pray together to gain mercy from the Eternal Father.

Dachsie
10th January 2021, 01:57 PM
What is in the COVID-19 Vaccines?

https://www.thrivetimeshow.com/business-podcasts/dr-christiane-northrup-whats-inside-the-covid-19-vaccines/

Dr. Christiane Northrup | What’s Inside the COVID-19 Vaccines?

embeded video at

https://rumble.com/vbtqy5-dr.-christiane-northrup-whats-inside-the-covid-19-vaccines.html?mref=6zof&mrefc=4

3X New York Times Best-selling Author Dr. Northrup Shares About the Fetal-Tissue Filled RNA-Modifying Luciferase 060606 Patent COVID-19 Vaccines

See What’s Inside the AstraZeneca COVID-19 Vaccines – https://www.bitchute.com/video/RbOS7ouELtTe/



See What’s Inside the COVID-19 Vaccines with Dr. Carrie Madej – https://www.bitchute.com/video/Io5lzbGLUkVU/

Luciferase gene-loaded CS-Qdots as self-illuminating probes for specific hepatoma imaging – https://rsc.li/2QdtWcw

Why “Operation Warp Speed” Could Be Deadly – https://bit.ly/2FP1qvZ

Mandatory Vaccines is already law! There is already precedence! This should amaze, shock and terrify you! – https://bit.ly/32h8Uzh

Chloroquine is a potent inhibitor of SARS coronavirus infection and spread – https://bit.ly/34mIAGz

Bill Gates predicts 700,000 victims from corona vaccination – https://bit.ly/3hjROqY

Moderna’s mRNA vaccine reaches its final phase. Here’s how it works – https://on.natgeo.com/32kgolj

Moderna’s Mysterious Coronavirus Vaccine Delivery System – https://bit.ly/3l91xmd

Gene Drive Files Expose Leading Role of US Military in Gene Drive Development. – https://bit.ly/3laJHPO

‘Gene drive’ research to fight diseases can proceed cautiously, U.N. group decides – https://wapo.st/3aMc7uy

Bill Gates wants to WHAT??! Depopulation Through Vaccines and Healthcare? – https://youtu.be/iMl0ty6evhU

Bill Gates caught on video admitting vaccine will CHANGE our DNA FOREVER – https://youtu.be/ksEVaO806Oo

BILL GATES | NO CHOICE | VACCINATE THE ENTIRE PLANET – https://youtu.be/KAAZD7QSDiM

Bill Gates Predicted Corona Virus on Tedx – https://youtu.be/Ofdd4ILdpVY

Genetically by Modified Crops: An Overview – https://bit.ly/2QcPvdc

INOVIO’s COVID-19 DNA Vaccine INO-4800 Demonstrates Robust Neutralizing Antibody and T Cell Immune Responses in Preclinical Models – https://bit.ly/34mJhQb

What you always needed to know about electroporation based DNA vaccines – https://bit.ly/32dFjXG

AstraZeneca to be exempt from coronavirus-vaccine liability claims in most countries – https://tgam.ca/3giHFcM

20 Things You Didn’t Know About… DNA – https://bit.ly/3lbaFXB

Gene-editing, Moderna, and transhumanism – https://bit.ly/3l92omV

A nanomaterial path forward for COVID-19 vaccine development – https://bit.ly/2QhsB4o

RNA virus vectors: Where are we and where do we need to go? – https://bit.ly/2QhT3Lm

This potential coronavirus vaccine could be as easy as sticking on a bandage – https://on.mktw.net/2Qg2wmj

Nanorobot Hardware Architecture for Medical Defense – https://bit.ly/329zpGI

Quantum Dots Deliver Vaccines and Invisibly Encode Vaccination History in Skin – https://bit.ly/3hm4hua

Venomous snake fangs inspire new microneedle drug-delivery system – https://bit.ly/2QcQcmO

Scientists Propose ‘Tattoos’ To Solve Vaccination Issues – https://bit.ly/2FKUHmB

Introduction to Transfection – https://bit.ly/3ljqXxE

Injectable Body Sensors Take Personal Chemistry to a Cell Phone Closer to Reality – https://bit.ly/3jhBho7

Transhumanism And The Future Of Humanity: 7 Ways The World Will Change By 2030 – https://bit.ly/329zBpq

A nanomaterial path forward for COVID-19 vaccine development – https://bit.ly/2YlALNC

Invisible Ink Could Reveal whether Kids Have Been Vaccinated – https://bit.ly/3ggInad

Biocompatible near-infrared quantum dots delivered to the skin by microneedle patches record vaccination – https://bit.ly/2CQKqnZ

DoD Funding Vaccine, Therapy Delivery Device – https://bit.ly/34kFbIt

Learn more at https://timetofreeamerica.com

It would be ideal if you could direct people to Dr. Northrup’s website and Free E-newsletter. Here are the details:

SIGN UP FOR THE DR. CHRISTIANE NORTHRUP E-NEWSLETTER: For health and lifestyle tips that Dr. Northrup recommends, sign up for her FREE biweekly e Newsletter. You will get up-to-date-information, and learn about events that can put you on your path toward better health and vitality. To sign up for her FREE biweekly eNews visit https://www.drnorthrup.com/newsletter

WATCH This – http://1986theact.com/

WATCH This – https://www.drnorthrup.com/

https://www.mercola.com/

www.NVIC.com

www.MAMM.com

www.CHD.org



MRC-5 – MRC-5 (Medical Research Council cell strain 5) is a diploid cell culture line composed of fibroblasts, originally developed from the lung tissue of a 14-week-old aborted Caucasian male fetus.[1][2] The cell line was isolated by J.P. Jacobs and colleagues in September 1966 from the seventh population doubling of the original strain, and MRC-5 cells themselves are known to reach senescence in around 45 population doublings

Narcolepsy – A chronic sleep disorder that causes overwhelming daytime drowsiness.

Yes, yes, yes and yes! Thrive Nation on today’s show we are interviewing the 3x New York times best-selling author and the board-certified OB/GYN physician, Dr. Northrup to take a look at what is really inside the COVID-19 vaccines being pushed by the mainstream media? Dr. Northrup, welcome onto the Thrivetime Show, how are you doctor?! https://www.drnorthrup.com/about/
Dr, before we get too deep into today’s interview, can you briefly share your background so that our listeners who don’t know who you are will understand the level of credibility that you are bringing to the table?
Dr. what does every human on the planet need to know about the COVID-19 vaccines?
Doctor, what are your fears for the people that do choose to take the vaccine?
Doctor, this vaccine uses a technology called transfection, what does transfection do?
Doctor, MIT has done work to allow your medical information to be stored below the skin’s surface using a die called, Luciferase? I would love for you to break down how this works and is it actually called Luciferase?
Doctor, when researching these vaccines I have discovered that nano-technology (like little robots) is in the vaccines…what does that mean?
Doctor, my understanding is that Bill and Melinda Gates on March 26th, 2020 applied for a patent number 060606, what is their patent all about?
Doctor is the world patent number actually, 060606?
Doctor Northrup, 99.9% of people recover from COVID-19, why do we need a vaccine at all, let alone a RNA-Modifying Luciferase 06060 COVID-19 Vaccine?
Doctor, we are being sold a narrative that things cannot and will not go back to normal until everyone gets this vaccine. Why is this the narrative and what is really going on here?
Doctor, once somebody gets this RNA-Modifying Luciferase 06060 COVID-19 Vaccine…how does the human body interact with the 5G technology?
Doctor, I was looking the ingredients of the Astra-Zeneca COVID-19 vaccines and they include MRC-5, which is a cell line originally developed from the lung tissue of a 14-week-old aborted Caucasian male fetus. Is fetal tissue common in these COVID-19 vaccines?
Doctor, Jeffrey Epstein and Bill Gates became good friends after Jeffrey Epstein was convicted of pedophilia and Jeffrey Epstein was working to actually create his own race of people…should we be trusting Bill Gates with our health and about the COVID-19 vaccines?
Charles Lieber Created the Technology with Epstein – https://www.justice.gov/opa/pr/harvard-university-professor-and-two-chinese-nationals-charged-three-separate-china-related
Jeffrey Epstein Was Creating His Own Race of People “The Luciferase” – https://www.nytimes.com/2019/07/31/business/jeffrey-epstein-eugenics.html
Epstein Worked on Bioengineering His Own Race – https://www.foxbusiness.com/healthcare/epstein-paid-harvard-scientists-to-bioengineer-his-own-human-race
The Astra-Zeneca COVID-19 Vaccines – https://www.dropbox.com/s/e1y7boepw324ndb/Astra-Zeneca-%20COVID-19%20Vaccine.mov?dl=0
Read the Scripture – “And that no man might buy or sell, save he that had the mark, or the name of the beast, or the number of his name. Here is wisdom. Let him that hath understanding count the number of the beast: for it is the number of a man; and his number is Six hundred threescore and six.” – Revelation 13:17-18
How the PCR tests are creating an infinite and unwinnable game for America – https://thehighwire.com/videos/covid-testing-fraud-uncovered/
Dr. Richard Bartlett (the former top advisor the Governor of Texas, Rick Perry) shares how his protocol has been used to successfully treat 1,000 + deaths with 0 deaths – read his study at www.BudesonideWorks.com
How to End the “Pandemic Chaos” Immediately:
Authorize Budesonide to be available to all Americans (Over 3,000 COVID-19 Patients Treated with 0 Deaths) – www.BudesonideWorks.com
Dr. Richard Bartlett
Dr. Jim Meehan
Ban the Use of the Wrong Calibrated Fear Causing and False Positive Diagnosing PCR Tests –
https://thehighwire.com/videos/covid-testing-fraud-uncovered/
https://discover.hubpages.com/politics/Pfizer-Chief-Science-Officer-Second-Wave-Based-on-Fake-Data-of-False-Positives-for-New-Cases-Pandemic-is-Over?fbclid=IwAR3IypCjPlQn518OToyLO2-VGwne0tvxUxT8hYPNBQoOKSSpkqRSFUaI6JI
Dozens speak against Edmonton’s mask bylaw at city hall meeting
WATCH: https://rumble.com/vb8p79-chairman-of-a-covid-testing-company-says-its-all-rubbish.html
Article about what the ZOOM call was – https://www.cbc.ca/news/canada/edmonton/covid-19-city-council-mask-1.5802168
https://www.westernstandardonline.com/2020/11/senior-doc-says-alberta-politicians-playing-medicine-media-driving-hysteria/
Bio of Dr Roger Hodkinson
https://westernmedical.ca/employees/roger-g-hodkinson/
https://medmaldoctors.ca/dr-roger-hodkinson/


The Truth About The COVID-19 Vaccines And Bill Gates

Why Did Bill Gates, Dr. Fauci, The World Health Organization (WHO), and the National Institute of Allergy and Infectious Diseases (NIAID), All Decide to Openly Work Together to Create a “Global Vaccine”? https://www.gatesfoundation.org/Media-Center/Press-Releases/2010/12/Global-Health-Leaders-Launch-Decade-of-Vaccines-Collaboration
What’s in the COVID-19 Vaccines? – 3X New York Times Best-selling Author, Dr. Northrup Explains the RNA-MODIFYING CRYPTO-CURRENCY FILLED LUCIFERASE VACCINES – https://www.bitchute.com/video/6B02k1C1FnlK/
WATCH – FORCED CHIP WITH A TRACKING DEVICE – https://www.bitchute.com/video/AC17xoynao1y/
Why is Bill Gates Developing a Patent For a Cryptocurrency System Using Body Activity Data (Installing a Chip in the Human Body)?
Head of Pfizer Research: Covid Vaccine is Female Sterilization – https://healthandmoneynews.wordpress.com/2020/12/02/head-of-pfizer-research-covid-vaccine-is-female-sterilization/
Bill Gates and Dr. Fauci have the solution to the problem they created. https://patentscope.wipo.int/search/en/detail.jsf?docId=WO2020060606
Bill Gates is creating these models https://www.youtube.com/watch?v=9AEMKudv5p0&feature=youtu.be&fbclid=IwAR0T958LlsaKEHQW0AMM_JjilCM_9KEsrCMyehuL_ R5VbcbhxZ5D7gEhbuA
Watch at 1:52 – 2:50
Sending Out Contact Tracing Inspectors to Isolate People
https://truepundit.com/exclusive-bill-gates-negotiated-100-billion-contact-tracing-deal-with-democratic-congressman-sponsor-of-bill-six-months-before-coronavirus-pandemic/
Budesonide taken with a nebulizer = The $237 COVID-19 Cure
Download Dr. Bartlett’s Case Study Report – https://docs.google.com/document/d/16Hz_SEZh4J_XrXPam2J-jWNcoBkn3DqfeeWBLp8-WUw/edit?usp=sharing
Bill Gates Recommends banning social gatherings, church services, and the ability to dissent forever until a “vaccine” is given to everyone https://www.youtube.com/watch?v=4X-KkQeMMSQ&t=3s – Watch at 17:20 – 18:04
Bill Gates Has Filed a Patent For a Cryptocurrency System Using Body Activity Data (Installing a Chip in the Human Body) – https://patentscope.wipo.int/search/en/detail.jsf?docId=WO2020060606
Requiring the User to Do Something is Nothing New for Bill Gates!The United States Versus Bill Gates – https://en.wikipedia.org/wiki/United_States_v._Microsoft_Corp.Bill Gates would be viewed as a criminal if it were not for his investment into Apple in exchange for Steve Jobs’ refusal to testify against Bill Gates.
Bill Gates Invests $150 million into Apple (the company he almost killed) https://www.cnbc.com/2017/08/29/steve-jobs-and-bill-gates-what-happened-when-microsoft-saved-apple.html
Bill Gates deposition highlight 1 – https://www.youtube.com/watch?v=jgm455M-N3Y
Bill Gates deposition highlight 2 – https://www.youtube.com/watch?v=gRelVFm7iJE
Steve Jobs announces Bill Gates investment https://www.youtube.com/watch?v=I3fBW6XkL34 – Watch at :48 seconds
Bill Gates, the co-founder of Microsoft spent a meaningful amount of time with the sex offender Jeffrey Epstein, according to reporting from The New York Times. Employees of Gates’ namesake foundation reportedly also met with Epstein, in multiple visits to the disgraced financier’s mansion. – https://www.nytimes.com/2019/10/12/business/jeffrey-epstein-bill-gates.html
Did You Know That the “Vaccine King” (Bill Gates) Traveled with Jeffrey Epstein? https://www.bitchute.com/video/IGy0pk1jg57z/
The Faux Generosity of the Super-Wealthy: Why Bill Gates is a Menace to Society – https://www.mintpressnews.com/faux-generosity-how-bill-gates-bought-his-power-and-influence/263208/
The Gates Foundation Donations to the World Health Organization Nearly Match Those from the United States Government – https://www.usnews.com/news/articles/2020-05-29/gates-foundation-donations-to-who-nearly-match-those-from-us-government
Bill and Melinda Gates Foundation is Listed As a Member / Partner of the World Health Organization – https://www.who.int/workforcealliance/members_partners/member_list/gates/en/
Why Is the Bill & Melinda Gates Foundation the Largest Non-State Funder of the World Health Organization That Declared COVID-19 as Being a “Pandemic?” – https://www.nvic.org/NVIC-Vaccine-News/January-2019/WHO,-Pharma,-Gates.aspx
Massachusetts Mandates Flu Vaccinations For Students Of All Ages – https://www.forbes.com/sites/tommybeer/2020/08/19/massachusetts-mandates-flu-vaccinations-for-students-of-all-ages/?fbclid=IwAR3aFjCARl7oUhsxM-_ejMwqbszruo2r8WtfWTXqitUN5UbzpZYh9DzueOI#55280816 126d
WHAT’S IN THE VACCINES? | LUCIFERASE GENE-LOADED CS-QDOTS AS SELF-ILLUMINATING PROBES
https://www.bitchute.com/video/Io5lzbGLUkVU/
A Defense Advanced Research Projects Agency (DARPA) -Funded Implantable Biochip To Detect COVID-19 Could Hit Markets By 2021
https://www.zerohedge.com/medical/darpa-funded-implantable-biochip-detect-covid-19-could-hit-markets-2021
CDC Admits Vaccines Contain ‘Aborted Human Fetus Cells’ – https://www.thestandardsc.org/baxter-dmitry/cdc-admit-vaccines-contain-aborted-human-fetus-cells/
Biotech Moderna’s COVID-19 vaccine investigator leaves FDA advisory committee over conflict of interest – https://www.fiercebiotech.com/biotech/moderna-s-covid-vaccine-investigator-leaves-fda-advisory-committee-over-conflict-interest?mkt_tok=eyJpIjoiTkRjNU9URXhNRE5pTVRNNSIsI nQiOiJkckVYUDNwU1JjZllLc1I3bDBqeXNncDFWamlIenNKdnd XbXRJWEIreU5RS0JFcWY1MkVSckVLNTNnVitXeldSaTA2QTFoN TNLRHdYa2lqRFV0cjlJWnRENnR2ZTNOUU13cTFMV3lhN01FWGh jS25EbUlUZXRaMTgrVmFMeEp3NiJ9&mrkid=829978
Why Are the COVID-19 Vaccines Filled RNA-Modifying Cryptocurrency Nano Technology? https://www.bitchute.com/video/6B02k1C1FnlK/
Does Injecting an RNA-Modifying Body-Activated Cryptocurrency with a Patent Number W02020060606 Named Luciferase Into Your Body Sound Like a Good Idea? – https://www.bitchute.com/video/6B02k1C1FnlK/
Did you know the Harvard University professor who created the nanotechnology to be included in the RNA-modifying vaccines failed to disclose that he was working with the Chinese? – https://www.justice.gov/opa/pr/harvard-university-professor-indicted-false-statement-charges
Did you know that Jeffery Epstein was working with Harvard and Bill Gates to create his own race of people before his arrests for pedaphelia related charges?
https://www.nytimes.com/2019/07/31/business/jeffrey-epstein-eugenics.html
https://www.independent.co.uk/news/world/americas/jeffrey-epstein-seed-human-race-dna-baby-ranch-new-mexico-eugenics-a9030411.html
https://www.theguardian.com/us-news/2019/aug/01/jeffrey-epstein-seed-human-race-report
And that no man might buy or sell, save he that had the mark, or the name of the beast, or the number of his name. Here is wisdom. Let him that hath understanding count the number of the beast: for it is the number of a man; and his number is Six hundred threescore and six.
– Revelation 13:17-18
Bamlanivimab for COVID-19 – Guess Who is Investing in the FDA Emergency Authorized Bamlanivimab
https://www.lilly.com/news/media/media-kits/bamlanivimab-covid19
https://investor.lilly.com/news-releases/news-release-details/lilly-announces-arrangement-supply-potential-covid-19-antibody
Mark of the Beast Technology? | Clay Clark with Anna Khait – https://www.bitchute.com/video/CwpNkzID8pOY/
Former FEMA operative Celeste Solum talks with David Icke: ‘The Covid tests are magnetically tagging you and the vaccine is designed for mass depopulation and the synthetic transformation of the human body’ – https://79days.news/watch?id=5fb6649993b2894247f3c9b4
WATCH – Mandatory Vaccines Are The Globalists Hail Mary For Complete Control – http://banned.video/watch?id=5fb5cf2c8cb061413d943955
WATCH – AstraZenenca COVID-19 Vaccines Include Lung Tissue from a 14 Month-Old Aborted Male Human Fetus (Baby) – https://www.bitchute.com/video/RbOS7ouELtTe/
Former FEMA operative Celeste Solum talks with David Icke: ‘The Covid tests are magnetically tagging you and the vaccine is designed for mass depopulation and the synthetic transformation of the human body’ – https://79days.news/watch?id=5fb6649993b2894247f3c9b4
The COVID-19 Vaccines Include MRC-5. What is MRC-5? MRC-5 is a cell line originally developed from the lung tissue of a 14-week-old aborted Caucasian male fetus and you can buy it here – https://www.coriell.org/0/Sections/Search/Sample_Detail.aspx?Ref=AG05965-C
The Bill Gates, George Soros, and Dr. Fauci Connection Runs Deep – SEE PHOTO – https://nationalfile.com/fauci-photographed-with-soros-and-bill-gates-father-who-was-head-of-planned-parenthood/
Bill Gates predicts when the next pandemic will arrive – https://en.as.com/en/2020/11/24/latest_news/1606228590_532670.html
PCR tests NeuMoDx Molecular –
https://www.gatesfoundation.org/How-We-Work/Quick-Links/Grants-Database/Grants/2011/11/OPP1028850
https://corporate.qiagen.com/newsroom/press-releases/2018/20180917_neumodx_partnership?sc_lang=en
CNN: ‘Don’t Be Alarmed’ if People Start Dying After Taking the Vaccine – https://www.infowars.com/posts/cnn-dont-be-alarmed-if-people-start-dying-after-taking-the-vaccine
Two in U.K. Suffer Allergic Reaction to Pfizer’s Covid-19 Vaccine Regulator says people with history of significant allergic reactions shouldn’t get the shot – https://www.wsj.com/articles/people-with-severe-allergies-shouldnt-get-covid-19-vaccine-says-u-k-regulator-after-reactions-11607515727
Look what’s inside the Pfizer Covid-19 Vaccines – https://www.dropbox.com/s/i0yxtw244g8tl63/CAN%20COVID19%20vaccine.pdf?dl=0
https://www.dropbox.com/s/qfw3l5d3555vzll/VRBPAC-12.10.20-Meeting-Briefing-Document-Sponsor.pdf?dl=0
WATCH – https://www.youtube.com/watch?v=fdV3b8Lizf0

PROVEN TREATMENTS:

“If you take ivermectin for COVID-19 you will not get sick.” | 100% Effective COVID-19 Treatments – https://www.bitchute.com/video/OzrAVkI3nLIf/
Early Outpatient Treatment Protocol for CoVID-19 – Jim Meehan, MD – https://docs.google.com/document/d/1pCf0TRgooG6LFNRzW7V-MzQAH5zyAfX9sNGOUQZqDwA/edit?usp=sharing

Read “The Great Reset” by Klaus Schwab and Thierry Malleret –

https://www.dropbox.com/s/udmbwhrq30y39vj/COVID-19_-The-Great-Reset-Klaus-Schwab.pdf?dl=0

The Truth About the Center for Disease Control’s Recommended Nazi-Style Quarantine Isolation Camps:

The CDC recommends using Nazi-style quarantine/concentration camps
The CDC is calling for Nazi like camps in simple language:
https://www.cdc.gov/coronavirus/2019-ncov/global-covid-19/shielding-approach-humanitarian.html?fbclid=IwAR1byTYoGL8zupfbM20skhR 0nLoYAgePAGRxx-etTfbVcaL0VFama-WA490
Bill Gates recommends vaccinating every human on the planet with his “Luciferase” vaccines
The Creators of the Technology –
Charles Lieber Created the Technology with Epstein – https://www.justice.gov/opa/pr/harvard-university-professor-and-two-chinese-nationals-charged-three-separate-china-related
Jeffrey Epstein Was Creating His Own Race of People “The Luciferase” – https://www.nytimes.com/2019/07/31/business/jeffrey-epstein-eugenics.html
Epstein Worked on Bioengineering His Own Race – https://www.foxbusiness.com/healthcare/epstein-paid-harvard-scientists-to-bioengineer-his-own-human-race
The Astra-Zeneca COVID-19 Vaccines – https://www.dropbox.com/s/e1y7boepw324ndb/Astra-Zeneca-%20COVID-19%20Vaccine.mov?dl=0
Read the Scripture – “And that no man might buy or sell, save he that had the mark, or the name of the beast, or the number of his name. Here is wisdom. Let him that hath understanding count the number of the beast: for it is the number of a man; and his number is Six hundred threescore and six.” – Revelation 13:17-18

PatColo
10th January 2021, 05:19 PM
Irishman Dave Cullen / Computing Forever is quite enthused re this one, pub'd Jan 5,

41m
STERILISATION (https://www.bitchute.com/video/uqu5rR8JK5YV/)

I notice his YT ch which recently broke 500 K sub's, was finally gassed

PatColo
10th January 2021, 05:30 PM
5 most recent @ winterwatch


https://www.winterwatch.net/wp-content/uploads/2018/09/Social-Media-purge.jpg (https://www.winterwatch.net/2021/01/new-wave-of-social-media-purges-internet-censorship-follows-kabuki-capitol-incursion/)
New Wave of Social Media Purges, Internet Censorship Follows Kabuki Capitol Incursion (https://www.winterwatch.net/2021/01/new-wave-of-social-media-purges-internet-censorship-follows-kabuki-capitol-incursion/)

January 10, 2021 29 (https://www.winterwatch.net/2021/01/new-wave-of-social-media-purges-internet-censorship-follows-kabuki-capitol-incursion/#mh-comments)
‘Revolutions are effected in two ways: by force and by fraud. In some cases, when fraud is used, the citizens are deceived into acquiescing to [...] (https://www.winterwatch.net/2021/01/new-wave-of-social-media-purges-internet-censorship-follows-kabuki-capitol-incursion/)



https://www.winterwatch.net/wp-content/uploads/2018/07/pilpul.jpg (https://www.winterwatch.net/2021/01/the-use-of-pilpul-to-cloud-and-obscure-issues-and-discussions/)
The Use of Jewish Pilpul to Cloud and Obscure Issues and Discussions (https://www.winterwatch.net/2021/01/the-use-of-pilpul-to-cloud-and-obscure-issues-and-discussions/)

January 9, 2021 17 (https://www.winterwatch.net/2021/01/the-use-of-pilpul-to-cloud-and-obscure-issues-and-discussions/#mh-comments)
When one wades through forums and encounters “debate” the way I have, you can’t help but run into the annoying tactic of rhetoric called pilpulering. [...] (https://www.winterwatch.net/2021/01/the-use-of-pilpul-to-cloud-and-obscure-issues-and-discussions/)








https://www.winterwatch.net/wp-content/uploads/2021/01/Capitol-Siege-protest-central-casting-326x245.jpg (https://www.winterwatch.net/2021/01/divide-and-conquer-dc-capital-siege-psyop-a-fiat-accompli/)
Divide-and-Conquer DC ‘Capitol Siege’ Psyop a Fiat Accompli (https://www.winterwatch.net/2021/01/divide-and-conquer-dc-capital-siege-psyop-a-fiat-accompli/)

January 8, 2021 85 (https://www.winterwatch.net/2021/01/divide-and-conquer-dc-capital-siege-psyop-a-fiat-accompli/#mh-comments)
It should be glaringly obvious that the D.C. Capitol breach (aka “Capitol Siege”) was a set up to tarnish the populist movement. There was no special smoke and mirrors or black magick either. All it [...] (https://www.winterwatch.net/2021/01/divide-and-conquer-dc-capital-siege-psyop-a-fiat-accompli/)







https://www.winterwatch.net/wp-content/uploads/2021/01/Covid-vaccine-recovery-station-326x245.jpg (https://www.winterwatch.net/2021/01/only-the-beginning-heinous-side-effects-and-death-from-covid-trans-human-injections/)
Only the Beginning: Heinous Side Effects and Death from Covid Trans-Human Injections (https://www.winterwatch.net/2021/01/only-the-beginning-heinous-side-effects-and-death-from-covid-trans-human-injections/)

January 7, 2021 76 (https://www.winterwatch.net/2021/01/only-the-beginning-heinous-side-effects-and-death-from-covid-trans-human-injections/#mh-comments)
Winter Watch welcomes special guest writer Giuseppe Vafanculo. He’s a former professional journalist with more than 500 byline articles in major-market newspapers and magazines in the 1980s. His midlife career change led him to graduate [...] (https://www.winterwatch.net/2021/01/only-the-beginning-heinous-side-effects-and-death-from-covid-trans-human-injections/)







https://www.winterwatch.net/wp-content/uploads/2020/11/The-Wisdom-Circle-326x245.jpg (https://www.winterwatch.net/2021/01/russ-winter-rejoins-the-wisdom-circles-dave-scorpio-giuseppe-vafanculo-for-a-wide-ranging-conversation/)
Russ Winter Rejoins ‘The Wisdom Circle’ of Dave Scorpio, Giuseppe Vafanculo for a Wide-Ranging Conversation (https://www.winterwatch.net/2021/01/russ-winter-rejoins-the-wisdom-circles-dave-scorpio-giuseppe-vafanculo-for-a-wide-ranging-conversation/)

January 7, 2021
‘Mr Bond, they have a saying in Chicago: ‘Once is happenstance. Twice is coincidence. The third time it’s enemy action.” ― author Ian Fleming, ‘Goldfinger’ During this show, our trio cover a range of timely topics. Great [...] (https://www.winterwatch.net/2021/01/russ-winter-rejoins-the-wisdom-circles-dave-scorpio-giuseppe-vafanculo-for-a-wide-ranging-conversation/)

Dachsie
11th January 2021, 07:31 AM
5 most recent @ winterwatch


https://www.winterwatch.net/wp-content/uploads/2018/09/Social-Media-purge.jpg (https://www.winterwatch.net/2021/01/new-wave-of-social-media-purges-internet-censorship-follows-kabuki-capitol-incursion/)
New Wave of Social Media Purges, Internet Censorship Follows Kabuki Capitol Incursion (https://www.winterwatch.net/2021/01/new-wave-of-social-media-purges-internet-censorship-follows-kabuki-capitol-incursion/)

January 10, 2021 29 (https://www.winterwatch.net/2021/01/new-wave-of-social-media-purges-internet-censorship-follows-kabuki-capitol-incursion/#mh-comments)
‘Revolutions are effected in two ways: by force and by fraud. In some cases, when fraud is used, the citizens are deceived into acquiescing to [...] (https://www.winterwatch.net/2021/01/new-wave-of-social-media-purges-internet-censorship-follows-kabuki-capitol-incursion/)



https://www.winterwatch.net/wp-content/uploads/2018/07/pilpul.jpg (https://www.winterwatch.net/2021/01/the-use-of-pilpul-to-cloud-and-obscure-issues-and-discussions/)
The Use of Jewish Pilpul to Cloud and Obscure Issues and Discussions (https://www.winterwatch.net/2021/01/the-use-of-pilpul-to-cloud-and-obscure-issues-and-discussions/)

January 9, 2021 17 (https://www.winterwatch.net/2021/01/the-use-of-pilpul-to-cloud-and-obscure-issues-and-discussions/#mh-comments)
When one wades through forums and encounters “debate” the way I have, you can’t help but run into the annoying tactic of rhetoric called pilpulering. [...] (https://www.winterwatch.net/2021/01/the-use-of-pilpul-to-cloud-and-obscure-issues-and-discussions/)








https://www.winterwatch.net/wp-content/uploads/2021/01/Capitol-Siege-protest-central-casting-326x245.jpg (https://www.winterwatch.net/2021/01/divide-and-conquer-dc-capital-siege-psyop-a-fiat-accompli/)
Divide-and-Conquer DC ‘Capitol Siege’ Psyop a Fiat Accompli (https://www.winterwatch.net/2021/01/divide-and-conquer-dc-capital-siege-psyop-a-fiat-accompli/)

January 8, 2021 85 (https://www.winterwatch.net/2021/01/divide-and-conquer-dc-capital-siege-psyop-a-fiat-accompli/#mh-comments)
It should be glaringly obvious that the D.C. Capitol breach (aka “Capitol Siege”) was a set up to tarnish the populist movement. There was no special smoke and mirrors or black magick either. All it [...] (https://www.winterwatch.net/2021/01/divide-and-conquer-dc-capital-siege-psyop-a-fiat-accompli/)







https://www.winterwatch.net/wp-content/uploads/2021/01/Covid-vaccine-recovery-station-326x245.jpg (https://www.winterwatch.net/2021/01/only-the-beginning-heinous-side-effects-and-death-from-covid-trans-human-injections/)
Only the Beginning: Heinous Side Effects and Death from Covid Trans-Human Injections (https://www.winterwatch.net/2021/01/only-the-beginning-heinous-side-effects-and-death-from-covid-trans-human-injections/)

January 7, 2021 76 (https://www.winterwatch.net/2021/01/only-the-beginning-heinous-side-effects-and-death-from-covid-trans-human-injections/#mh-comments)
Winter Watch welcomes special guest writer Giuseppe Vafanculo. He’s a former professional journalist with more than 500 byline articles in major-market newspapers and magazines in the 1980s. His midlife career change led him to graduate [...] (https://www.winterwatch.net/2021/01/only-the-beginning-heinous-side-effects-and-death-from-covid-trans-human-injections/)







https://www.winterwatch.net/wp-content/uploads/2020/11/The-Wisdom-Circle-326x245.jpg (https://www.winterwatch.net/2021/01/russ-winter-rejoins-the-wisdom-circles-dave-scorpio-giuseppe-vafanculo-for-a-wide-ranging-conversation/)
Russ Winter Rejoins ‘The Wisdom Circle’ of Dave Scorpio, Giuseppe Vafanculo for a Wide-Ranging Conversation (https://www.winterwatch.net/2021/01/russ-winter-rejoins-the-wisdom-circles-dave-scorpio-giuseppe-vafanculo-for-a-wide-ranging-conversation/)

January 7, 2021
‘Mr Bond, they have a saying in Chicago: ‘Once is happenstance. Twice is coincidence. The third time it’s enemy action.” ― author Ian Fleming, ‘Goldfinger’ During this show, our trio cover a range of timely topics. Great [...] (https://www.winterwatch.net/2021/01/russ-winter-rejoins-the-wisdom-circles-dave-scorpio-giuseppe-vafanculo-for-a-wide-ranging-conversation/)





David Scorpio said on one of his recent shows that where he is in Equador, South America, it is possible to buy


Ivermectin, Inhaled Budesonide are available in Equador OVER THE COUNTER.

Do not know if any of these

and

Doxycycline,

and Hydroxychloroquine HCQ

are available anywhere in the USA or Mexico or elsewhere OVER THE COUNTER.

We need to SHARE any information about any of these alternative preventatives or treatments for bad case of the flu.

Dachsie
11th January 2021, 07:56 AM
https://www.bitchute.com/video/qWRwVy6whSJ0/

https://static-3.bitchute.com/live/cover_images/Rbtrop3rRlZl/qWRwVy6whSJ0_640x360.jpg

18:02 video runtime

Denis Rancourt, PhD on Covid-19 Data Deception, Masking and Gov't Malfeasance

First published at 15:02 UTC on January 10th, 2021.

channel image

Jim Fetzer

Jim Fetzer

2808 subscribers

Denis Rancourt, PhD, makes beautiful, logical statements about how we're being deceived - made to believe in a phony pandemic for the furtherance of an agenda that has nothing to do with public health.

Denis Rancourt PhD presentation July 2, 2020 on the most important things to know about COVID-19.
For references see the Ontario Civil Liberties Association website http://ocla.ca/

Learn about our COVID-19 legal challenge with Rocco Galati here: https://vaccinechoicecanada.com/media...

Mirrored from : https://www.youtube.com/watch?v=DDxVAaASdxQ
LESS
Category News & Politics
Sensitivity Normal - Content that is suitable for ages 16 and over

BigTech just purged the president of the United States and untold numbers of creators and users. We are working around the clock to keep up, but could do with extra help. Consider a $5 donation today. Thank you - BitChute.

Dachsie
11th January 2021, 09:02 AM
Amazing video by Amazing Polly

https://static-3.bitchute.com/live/cover_images/ZofFQQoDoqYT/aozZCGuB5hNa_640x360.jpg

39:17 video runtime

Everything is connected.

"Covid-19" in central to the thesis of this video.

https://www.bitchute.com/video/aozZCGuB5hNa/
[B]

First published at 02:42 UTC on January 6th, 2021.

#blackmail #greatreset #amazingpolly

channel image

Amazing Polly

99FreeMind

72964 subscribers

Wild ride! Lin Wood is tweeting about it & people are very upset. He's not crazy and this video explains why. Viewer comments from my last video provide interesting clues! TO SUPPORT MY WORK please go to my website- https://amazingpolly.net/contact.php NOTE: I can once again accept online contributions! OR you can get my PO Box Address to send something via regular mail. Thank you x1000 to all of you! We will win this thing!

References:
Lin Wood tweets: https://twitter.com/LLinWood

IPOT Nashville Evergreen: https://www.bitchute.com/video/3X4C5jouYCGo/

Amazing Polly Video re pizzagate: https://www.bitchute.com/video/5kpayw4PPvU/

Amazing Polly Psy Ops Goes Mainstream: https://www.bitchute.com/video/oMVvjzTMjMI/

Amazing Polly: How the CIA Broke America: https://www.bitchute.com/video/pZGqDv-tuAM/

Amazing Polly NXIVM : https://www.bitchute.com/video/Q48-ZHhAX-g/

Flint offers money for dirt on Trump: https://www.forbes.com/sites/janetwburns/2017/10/14/hustlers-larry-flynt-offers-10m-reward-for-info-that-impeaches-[SIZE=4]trump/?sh=d00f6a27355f

Hefner’s Blackmail tapes: https://nypost.com/2017/09/30/hefners-former-valet-reflects-on-pig-nights-with-hookers-and-hef/

James Holmes 1: https://denver.cbslocal.com/2015/05/06/theater-shooters-time-as-phd-student-scrutinized/

Michael Barden Twitter: https://twitter.com/MichaelBarden8/status/1344553745678442496

#99freemind #AmazingPolly #blackmail #uselections #GreatReset
LESS
Category News & Politics
Sensitivity Normal - Content that is suitable for ages 16 and over

________________________________

Part of the theme for this video touched on the "movie-like" quality of many false event (aka false flag events)

Attorney Dean Hartwell wrote about 4 books on 9-11-01 and one of them was titled "Was 9-11 a Movie." Amazon stopped carry Dean's 9-11 books and do not know where you can obtain a copy of this but am glad I got my copy.
Also I remember Dr. James Fetzer had a show guest who specialized in the topic of "story-boarding" that is how movie plots and screenplays are put together.

All of this splicing and piecing together just the right pieces to produce just the desired effect or result at just the right time is analogous to me to how this PLANdemic / SCAMdemic was constructed and how all false events of the last century are constructed and deployed.
The SCAMdemic is ongoing and neverending.

Just be aware and wise as serpents but as innocent as doves.

Dachsie
11th January 2021, 10:43 AM
[QUOTE=Dachsie;975577]https://www.bitchute.com/video/qWRwVy6whSJ0/

https://static-3.bitchute.com/live/cover_images/Rbtrop3rRlZl/qWRwVy6whSJ0_640x360.jpg

18:02 video runtime[SIZE=5]

Denis Rancourt, PhD on Covid-19 Data Deception, Masking and Gov't Malfeasance

First published at 15:02 UTC on January 10th, 2021.

channel image

Jim Fetzer

Jim Fetzer

2808 subscribers

Denis Rancourt, PhD, makes beautiful, logical statements about how we're being deceived - made to believe in a phony pandemic for the furtherance of an agenda that has nothing to do with public health.

Denis Rancourt PhD presentation July 2, 2020 on the most important things to know about COVID-19.
For references see the Ontario Civil Liberties Association website http://ocla.ca/

___________________________

Dachsie comments:

Pay particular attention to Dr. Rancourt's conclusions at

08:13 through 14:06

Regular seasonal flu but the way the fragile patient population was treated is what caused the acceleration of deaths. The government, like in state of New York, caused the acceleration of deaths, but overall number of deaths was not substantially more or changed from the previous winter flu season.

This seems to go against Giuseppe's idea that the flu strain this year was "weaponized" and released by human agents for political reasons. With Dr. Rancourt, it was just the regular winter flu that was handled to go along with political pandemic rhetoric and to support the panic and killer virus meme. The acceleration of deaths happened too late in the winter so that kind of indicates it was what they did to the patients that caused the deaths, not the virus itself.

In any interpretation, the malevolence of people like NY governor Coumo and Tony the Rat Fauci shows clearly in all this. Marxist / Communism is what the PLANdemic is all about. Population control. Eugenics. Kill off the useless eaters and get tighter control of the people by having them crazy and disabled with fear.

Dachsie
11th January 2021, 02:51 PM
https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-january-11-2021

focus on corona at 04:12 to 12:25

https://local12.com/news/nation-world/healthy-south-florida-doctor-died-2-weeks-after-receiving-covid-19-vaccine-cincinnati-gregory-michael-miami-beach-sinai

https://local12.com/resources/media/6e11c61b-3bb5-44b4-93a3-b472d960bb03-medium16x9_5.PNG?1610285284907

Gregory Michael died after taking the COVID-19 vaccine. (Facebook)

"MIAMI BEACH, Fla. (CBS12) — A 56-year-old doctor passed away this week two weeks after getting his first dose of a Pfizer COVID-19 vaccine.

Dr. Gregory Michael, a Miami-Beach obstetrician, was in good health, according to WPDE. Health officials from Florida and the Centers from Disease Control and Prevention are investigating whether the vaccine played a role in his death, which may be the country's first death linked to the vaccine.

Dr. Michael received his first dose of Pfizer's vaccine on Dec. 18 at Mount Sinai Medical Center, the Sun-Sentinel reported. Three days later, small spots began to appear on his feet and hands. He went to the emergency room at Mount Sinai, where he has worked in private practice for 15 years.

Michael's blood count was "far below normal ranges" and he was admitted into the ICU, according to the Sun-Sentinel. Just days before the last resort surgery, he suffered a stroke and died."

Michael's wife said in a Facebook post that he spent the pandemic delivering hundreds of babies and was a COVID-19 vaccine advocate.

_________________

Dachsie comment:

Here is the vidio about Dr. Michael's death where the thrombocytopenia is explained. This vaccine and possibly ALL vaccines cause auto-immune conditions in people because they cause antibodies in the body that cause the body to start attacking the body's own immune system. This happens in different ways for different people. ITP is one of those ways that causes serious life-threatening disease.

https://www.local10.com/news/local/2021/01/07/did-miami-beach-doctor-56-die-from-receiving-covid-19-vaccine/

This doctor died of a condition that Dr. Judy Mikovits mentioned several times in a video very recently posted in this thread --
Thrombocytopenia is a condition characterized by abnormally low levels of platelets, also known as thrombocytes, in the blood. A normal human platelet count ranges from 150,000 to 450,000 platelets per microliter of blood.

Idiopathic thrombocytopenic purpura (ITP) is a rare autoimmune disorder that causes you to have low platelet levels. Platelets are cell fragments that are found in the blood and normally help the blood to clot. In people with ITP, the body produces antibodies that attack and destroy the platelets.

Dachsie
11th January 2021, 03:10 PM
https://www.mostholyfamilymonastery.com/images/portuguese-nurse-dies-after-receiving-coronavirus-vaccine.jpg

https://www.mostholyfamilymonastery.com/news/portuguese-nurse-dies-after-receiving-coronavirus-vaccine/#.X_zMvRZMHIU

"Portuguese nurse dies after receiving coronavirus vaccine"
naturalnews.com

“A 41-year-old pediatric nurse from Portugal dropped dead not long after being injected with the first dose of Pfizer’s Wuhan coronavirus (COVID-19) vaccine.

Reportedly in ‘perfect health’ prior to getting jabbed, Sonia Azevedo, a mother who worked as a surgical assistant at the Instituto Portugues de Oncologia cancer hospital in Porto, was one of 538 healthcare workers at her facility who received the first dose of the Pfizer-BioNTech China virus jab on Dec. 30.

The day after receiving her shot, New Year’s Eve, Azevedo had dinner with her family. The following morning, Azevedo was found dead in her bed, which was a total shock to everyone who knew her and the prior state of her health.

‘I want to know what caused my daughter’s death,’ stated her father Abilio to the Portuguese tabloid Orreio da Manha.

According to Abilio, his daughter was ‘well and happy,’ and ‘never drank alcohol’ and ‘didn’t eat anything special or out of the ordinary.’

Initially, Azevedo was so proud to have been among the first to receive the vaccine that she took a picture of herself and made it her Facebook profile picture, along with the words: ‘Covid-19 vaccinated.’

“We don’t know what happened,” Azevedo’s daughter, Vania Figueiredo, also told the paper. ‘It all happened quickly and with no explanation.'”

Dachsie
12th January 2021, 10:50 AM
Del Bigtree theHighwire.com Important website

https://thehighwire.com/videos/covid19-connecting-the-dots/


COVID19: CONNECTING THE DOTS

COVID19: CONNECTING THE DOTS

he Most Controversial Film in the World Today; Fatal Flaw in the #Covid19 shot?; The Latest Covid Fashion Trend!

embedded vodeo

1:52:12 video runtime

#TheForbiddenDocumentary #ConnectTheDots #Covid19 #Health #ADE #AntibodyEnhancement

Dachsie
12th January 2021, 12:56 PM
Del Bigtree theHighwire.com Important website

https://thehighwire.com/videos/covid19-connecting-the-dots/


COVID19: CONNECTING THE DOTS

COVID19: CONNECTING THE DOTS

he Most Controversial Film in the World Today; Fatal Flaw in the #Covid19 shot?; The Latest Covid Fashion Trend!

embedded vodeo

1:52:12 video runtime

#TheForbiddenDocumentary #ConnectTheDots #Covid19 #Health #ADE #AntibodyEnhancement





https://plandemicseries.com/

Watch and/or download Plandemic Indoctrination FREE.

1:16:28 video runtime

I am able to watch for free at that link, but ran in to problems trying to do free download.

Am going to watch right now.

Dachsie
12th January 2021, 02:11 PM
ONE PISSED OFF DOCTOR - MASKS ARE KILLING YOU - TAKE THEM OFF NOW!

https://www.bitchute.com/video/GAM8LAI1TPfy/

https://www.bitchute.com/video/GAM8LAI1TPfy/



irst published at 17:09 UTC on January 12th, 2021.

channel image

Jim Fetzer

Jim Fetzer

2873 subscribers

https://static-3.bitchute.com/live/cover_images/Rbtrop3rRlZl/GAM8LAI1TPfy_640x360.jpg

6:50 video runtime

Dr. Eric N: (last name Naputi ) "You have to understand, the system is set up to kill people right now." ... "It is beyond out of control, it is now time to push back. You push back with knowledge, wisdom and actions. Enough is enough. Take off the mas…
Category News & Politics
Sensitivity Normal - Content that is suitable for ages 16 and over

Dachsie
12th January 2021, 04:23 PM
Michael Beller, FORMER (fired or resigned ? ) chief counsel for PBS (taxpayer funded Public Broadcasting System) caught on Project Veritas candid camera.

"What's great is that Covid is spiking in all the states right now

because either those people won't come out to vote for Trump, you know, the red states

or a lot of them are sick and dying."


___________________


https://twitter.com/JamesOKeefeIII/status/1349086710483841025

James O'Keefe
@JamesOKeefeIII
BREAKING: @PBS
FIRES Michael Beller, Principal Counsel, after @Project_Veritas
exposes him discussing “Molotov Cocktails” @WhiteHouse


PBS CEO Paula Kerger: “There is no place for hateful rhetoric at PBS"

Stay tuned, video of me questioning Beller on the street launches TONIGHT!

___________________

Here are some of the statements Beller made on tape:

“They’ll [Trump supporters] be raising a generation of intolerant, horrible people – horrible kids.”

“We go for all the Republican voters and Homeland Security will take their children away…we’ll put them into the re-education camps.”

“Enlightenment camps. They’re nice, they have Sesame Street characters in the classrooms, and they watch PBS all day.”

_________________________


https://www.youtube.com/watch?v=t1r2rdmWsPE

...https://www.youtube.com/watch?v=t1r2rdmWsPE...

2:19 video runtime


https://www.youtube.com/watch?v=u7nT9yD0WPU

...https://www.youtube.com/watch?v=u7nT9yD0WPU...

Dachsie
13th January 2021, 11:47 AM
https://thefreedomarticles.com/10-things-to-know-experimental-covid-vaccines/

10 Things You Need to Know about the Experimental COVID Vaccines
Published 6 hours ago on January 12, 2021
By Makia Freeman
experimental covid vaccines

As the experimental COVID vaccines are militarily deployed worldwide (being the weapon they are), here are 10 things you need to know about these dangerous, transhumanistic tools of destruction.
Promoted Content
Mgid
Protect Yourself From The New COVID Variant, This Will Help!
ZunchLabs
Sad News For Meghan Markle And Prince Harry
InstantHub
Photos Of Melania In Slovenia She Never Wanted Us To See
InstantHub
All The Times Cher Made Headlines For Her Indecent Outfits
StyleBistro
Experimental COVID Vaccines

https://397145-1250082-raikfcquaxqncofqfm.stackpathdns.com/wp-content/uploads/2021/01/experimental-covid-vaccines-768x553.jpg

As the experimental COVID vaccines are militarily deployed worldwide (being the weapon they are), here are 10 things you need to know about these dangerous, transhumanistic tools of destruction.

xperimental COVID Vaccines

are coming to town, being rolled out worldwide as the transhumanistic New World Order (NWO) agenda dictates. This next phase of the COVID scamdemic is an incredibly dangerous one – the phase where authorities take their sovereignty-violating ways a step further by actually penetrating the body with poison disguised as medicine. These new COVID vaccines are even worse than your plain old regular toxic, carcinogenic and mutogenic vaccines, because some of them (the mRNA vaccines made by Pfizer and Moderna) are a dangerously new exotic creature: tools that actively hijack your genes and reprogram them. Here’s 10 things you need to know about the COVID vax, plus a list at the end of the article of just some of the horrendous injuries and deaths it has caused thus far.
Experimental COVID Vaccines: Never-Before-Used Tools to Modify and Program Your Genetics

The COVID vaccines produced by Pfizer and Moderna are called mRNA (messenger RNA) vaccines – a completely new type of vaccine that has never been licensed or used on humans before. We have absolutely no idea what to expect from this vaccine, nor no way to know if it will be effective or safe. Traditional vaccines introduce pieces of a weakened virus to stimulate an immune response. mRNA vaccines inject molecules of synthetic genetic material from non-humans sources into your cells, thus hijacking your genes and permanently reprogramming them to produce antibodies to kill the alleged SARS-CoV-2 virus causing COVID (although, as regular readers of The Freedom Articles know, the virus has never been isolated, purified or proven 100% to exist). These newly created proteins are not regulated by your DNA and are thus completely foreign to your body.
Experimental COVID Vaccines: mRNA Vax is an Operating System

The mRNA vaccines of Moderna and Pfizer could barely be regarded as medicine in the traditional sense. They are transhumanistic tools to synthetically alter you at the genetic level. In fact, Moderna has even admitted on their website that their new COVID vaccines are an “operating system” and the “software of life”:

“Recognizing the broad potential of mRNA science, we set out to create an mRNA technology platform that functions very much like an operating system on a computer. It is designed so that it can plug and play interchangeably with different programs. In our case, the “program” or “app” is our mRNA drug – the unique mRNA sequence that codes for a protein.”

Catherine Austin Fitts has recently been pointing out that these tools are ‘vaccines’ in name only, called so to give them legal immunity from liability, when actually they are operating systems:

“Just as Gates installed an operating system in our computers, now the vision is to install an operating system in our bodies and use “viruses” to mandate an initial installation followed by regular updates. Now I appreciate why Gates and his colleagues want to call these technologies “vaccines.” If they can persuade the body politic that injectible credit cards or injectible surveillance trackers or injectable brain-macine interface nanotechnologies are “vaccines,” then they can enjoy the protection of a century or more of legal decisions and laws that support their efforts to mandate what they want to do.”

“Why are we calling these formulations “vaccines”? If I understand the history of case law, vaccines, in legal terms, are medicine. Intentional heavy metal poisoning is not medicine. Injectible surveillance components are not medicine. Injectible credit cards are not medicine. Injectible brain-machine interface is not a medicine. Immunity for insurance companies is not the creation of human immunity. We need to stop allowing these concoctions to be referred to by a word that the courts and the general population define and treat as medicine and protect from legal and financial liability.”

Experimental COVID Vaccines: Safety Abandoned

Vaccines usually take 7-20 years to adequately research, test and bring to market. The slew of COVID vaccines produced by Big Pharma companies are being rushed to market in less than 12 months, which is nowhere enough time to meet established safety standards. No long-term safety studies were conducted, so no one has any real idea of the danger these vaccines could cause down the line. Many of the trials only lasted 3-4 months. Animal trials, an important part of safety testing, were skipped. While long-term safety is completely unknown, short-term safety looks extremely sketchy (see next section and list of links at end of article). It is no understatement to say that much of the worldwide population has just become Big Pharma’s guinea pigs.
Experimental COVID Vaccines: Dangerous Adverse Effects

The COVID vaccines promote disease enhancement due to pathogenic priming. In other words, they make people sicker than the disease would have. In Moderna’s trials alone, FDA documents record that 13 people died (6 from the vaccine and 7 from the placebo), while the FDA also issued a new warning regarding Bell’s Palsy as a potential side effect (results were correct up until December 3rd 2020). Since the rollout of the COVID vax, doctors and nurses have fainted live on TV (nurse manager Tiffany Dover fainted while speaking to the media about receiving the vaccine, and later died), contracted Bell’s palsy and become paralyzed. Some people have even died following the vaccine, including in places like Miami, Portugal, Israel, Switzerland, Iceland and more (see links in last section of article).
Experimental COVID Vaccines: COVID Vax Only Designed to Stop Mild Symptoms

With the risks of the COVID vaccine so undeniably grave, you might think the benefits are large. Think again. Big Pharma has stated that the vaccine only protects against mild (not moderate or severe) symptoms, which makes the vaccine virtually pointless, given the large majority of people who allegedly have COVID have little or no symptoms whatsoever.
The study Will covid-19 vaccines save lives? Current trials aren’t designed to tell us published in the BMJ (British Medical Journal) by Professor Peter Doshi raises at least 2 very good points about the failure of the COVID vaccines to stop moderate/severe symptoms and to stop transmission. He quotes, among others, Moderna chief medical officer Tal Zaks:

“But what will it mean exactly when a vaccine is declared “effective”? To the public this seems fairly obvious. “The primary goal of a covid-19 vaccine is to keep people from getting very sick and dying,” a National Public Radio broadcast said bluntly. Peter Hotez, dean of the National School of Tropical Medicine at Baylor College of Medicine in Houston, said, “Ideally, you want an antiviral vaccine to do two things . . . first, reduce the likelihood you will get severely ill and go to the hospital, and two, prevent infection and therefore interrupt disease transmission.” Yet the current phase III trials are not actually set up to prove either. None of the trials currently under way are designed to detect a reduction in any serious outcome such as hospital admissions, use of intensive care, or deaths. Nor are the vaccines being studied to determine whether they can interrupt transmission of the virus.”

“Tal Zaks, chief medical officer at Moderna, told The BMJ that the company’s trial lacks adequate statistical power to assess those outcomes. “The trial is precluded from judging [hospital admissions], based on what is a reasonable size and duration to serve the public good here,” he said. Hospital admissions and deaths from covid-19 are simply too uncommon in the population being studied for an effective vaccine to demonstrate statistically significant differences in a trial of 30 000 people. The same is true of its ability to save lives or prevent transmission: the trials are not designed to find out. Zaks said, “Would I like to know that this prevents mortality? Sure, because I believe it does. I just don’t think it’s feasible within the timeframe [of the trial]—too many would die waiting for the results before we ever knew that.” What about Hotez’s second criterion, interrupting virus transmission, which some experts have argued should be the most important test in phase III studies? “Our trial will not demonstrate prevention of transmission,” Zaks said, “because in order to do that you have to swab people twice a week for very long periods, and that becomes operationally untenable.”“

Experimental COVID Vaccines: COVID Vax Not Designed to Stop Transmission

Likewise, Big Pharma admitted they didn’t design the vaccine to stop transmission. Therefore, if someone else gets the vaccine, it doesn’t stop them from transmitting the virus to you, and if you get the vaccine, it does not stop you from transmitting the virus to others. This may be why NIAID head Dr. Anthony Fauci continued to push the dehumanizing agenda when he stated on MSM TV that people should still socially distance and wear masks even after getting vaccinated:

“Obviously, with a 90+% effective vaccine, you could feel much more confident [about not getting sick] … but I would recommend to people to not abandon all public health measures just because you have been vaccinated.”

https://397145-1250082-raikfcquaxqncofqfm.stackpathdns.com/wp-content/uploads/2021/01/MHRA-7.png

Experimental COVID Vaccines: No Real Isolated Virus Was Used to Make the Vaccine

The vaccine cannot possible be truly effective since it was not based on an actual isolated sample of the SARS-CoV-2 virus. The WHO protocols that Pfizer used to produce the mRNA do not appear to identify any nucleotide sequences that are unique to the SARS-CoV-2 virus. I have been covering this point ever since the COVID scamdemic began, especially in articles like SARS-CoV-2: The Stitched Together, Frankenstein Virus where I highight that COVID or SARS-CoV-2 is a theoretical digital virus, constructed from a computer database, that doesn not exist in the real world. Fran Leader questioned the UK MHRA (Medicines and Healthcare products Regulatory Agency) about this, asserting that the ‘virus’ was actually a computer generated genomic sequence, and ultimately they confirmed:

“The DNA template does not come directly from an isolated virus from an infected person.”

Experimental COVID Vaccines: WHO Admits There’s No Evidence COVID Vax Works

The World Health Organization chief scientist Soumya Swaminathan Yadav admitted that there is no “evidence on any of the [COVID] vaccines to be confident that it’s going to prevent people from actually getting the infection and therefore being able to pass it on.”
Experimental COVID Vaccines: Contains PEGylated Lipid Nanoparticles Which Can Cause Disease

Dr. Frank Shallenberger writes about the dangers of PEGylated lipid nanoparticles which are used to hide the mRNA from our bodies:
Promoted Content

“The mRNA molecule is vulnerable to destruction. So, in order to protect the fragile mRNA strands while they are being inserted into our DNA they are coated with PEGylated lipid nanoparticles. This coating hides the mRNA from our immune system which ordinarily would kill any foreign material injected into the body. PEGylated lipid nanoparticles have been used in several different drugs for years. Because of their effect on immune system balance, several studies have shown them to induce allergies and autoimmune diseases. Additionally, PEGylated lipid nanoparticles have been shown to trigger their own immune reactions, and to cause damage to the liver.”

Experimental COVID Vaccines: Pfizer Vaccine Fallout

An astonishing number of people have been hurt, damaged, injured and killed from the Pfizer COVID vax. Take a look at the following headlines, data and links from our friends at For Our Rights:
CDC data shows that 3,150 people are now “unable to perform normal daily activities, unable to work” after vaccination. This is 2.7% of people who took it

https://www.cdc.gov/vaccines/acip/meetings/downloads/slides-2020-12/slides-12-19/05-COVID-CLARK.pdf

Portuguese health worker, 41, dies two days after getting the Pfizer covid vaccine as her father says he “wants answers”

https://trib.al/eEWi66p
Mexican doctor hospitalized after receiving COVID-19 vaccine

https://www.reuters.com/article/health-coronavirus-mexico-vaccines-idUSKBN2970H3
Hundreds of Israelis get infected with Covid-19 after receiving Pfizer/BioNTech vaccine

https://www.rt.com/news/511332-israel-vaccination-coronavirus-pfizer/
Wife of ‘perfectly healthy’ Miami doctor, 56, who died of a blood disorder 16 days after getting Pfizer Covid-19 vaccine is certain it was triggered by the jab, as drug giant investigates first death with a suspected link to shot

https://www.dailymail.co.uk/news/article-9119431/Miami-doctor-58-dies-three-weeks-receiving-Pfizer-Covid-19-vaccine.html
75-year-old Israeli man dies 2 hours after getting Covid-19 vaccine

https://www.israelnationalnews.com/News/News.aspx/293865
Death of Swiss man after Pfizer vaccine

https://www.reuters.com/article/us-health-coronavirus-swiss-death-idUSKBN29413Y
88-year-old collapses and dies several hours after being vaccinated

https://www.israelnationalnews.com/News/News.aspx/293952
Thousands negatively affected after getting Covid-19 vaccine

https://m.theepochtimes.com/thousands-negatively-affected-after-getting-covid-19-vaccine_3625914.html
Hospital worker with no prior allergies in intensive care with severe reaction after Pfizer Covid vaccine

https://metro.co.uk/2020/12/16/hospital-worker-in-intensive-care-after-suffering-severe-allergic-reaction-to-covid-vaccine-13763695/
4 volunteers develop FACIAL PARALYSIS after taking Pfizer Covid-19 jab, prompting FDA to recommend ‘surveillance for cases’

https://www.rt.com/usa/509081-pfizer-vaccine-fda-bells-palsy-covid/
Investigation launched as 2 people die in Norway nursing home days after receiving Pfizer’s Covid-19 vaccine

https://www.rt.com/news/511623-norway-covid19-vaccine-deaths/
Hundreds Sent to Emergency Room After Getting COVID-19 Vaccines

https://m.theepochtimes.com/hundreds-sent-to-emergency-room-after-getting-covid-19-vaccines_3644148.html
US officials report more severe allergic reactions to COVID-19 vaccines

https://www.google.com/amp/s/mobile.reuters.com/article/amp/idUSKBN29B2GS
NHS told not to give COVID vaccine to those with history of allergic reactions

https://www.google.com/amp/s/amp.theguardian.com/world/2020/dec/09/pfizer-covid-vaccine-nhs-extreme-allergy-sufferers-regulators-reaction
COVID-19: Single vaccine dose leads to ‘greater risk’ from new coronavirus variants, South African experts warn

news.sky.com/story/amp/covid-19-single-vaccine-dose-leads-to-greater-risk-from-new-coronavirus-variants-south-african-experts-warn-12180837
CDC reveals at least 21 Americans have suffered life threatening allergic reactions to Pfizer’s COVID vaccine

www.dailymail.co.uk/health/article-9119029/amp/At-21-Americans-life-threatening-anaphylaxis-receiving-Pfizers-vaccine-CDC-reveals.html
Woman experiences side effects of COVID-19 vaccine

www.everythinglubbock.com/news/local-news/woman-experiences-side-effects-of-covid-19-vaccine/amp/
COVID vaccine side effects more common after 2nd dose

www.boston.cbslocal.com/2021/01/05/covid-vaccine-side-effects-fever-reaction/amp/
Bulgaria reports 4 cases of side effects from Pfizer COVID vaccine

www.ndtv.com/world-news/bulgaria-reports-4-cases-of-side-effects-from-pfizer-covid-vaccine-2347667%3famp=1&akamai-rum=off
Two NHS workers suffer allergic reaction to Pfizer vaccine

https://www.google.com/amp/s/www.telegraph.co.uk/global-health/science-and-disease/coronavirus-news-vaccine-pfizer-nhs-oxford-covid-uk-cases/amp/
Conclusion: Watch Out!

The above are just 10 reasons to watch out for the COVID vax, however for those wishing to dig deeper, I suggest investigating things such as unsafe epitopes (parts of proteins capable of causing immune and auto-immune conditions), ADE (antibody-dependent amplification, long known from experiments with corona vaccines in cats. All cats that initially tolerated the vaccine well, died after catching the wild virus), nanoparticles (graphene and hydrogel) and more, all of which are likely linked to the COVID vaccines. These concoctions take the NWO scheme to a whole new level. The agenda has arrived at your doorstep and, indeed, at your bloodstream.

Makia Freeman is the editor of alternative media / independent news site The Freedom Articles, author of the book Cancer: The Lies, the Truth and the Solutions and senior researcher at ToolsForFreedom.com. Makia is on Steemit and Parler.

Dachsie
14th January 2021, 01:09 PM
Dachsie: This applies only to Spain and other European countries, but who knows for sure about USA.

https://www.mostholyfamilymonastery.com/news/images/spain-to-maintain-a-list-of-people-who-refuse-coronavirus-vaccinations.jpg
_________________
https://www.naturalnews.com/2021-01-12-spain-keep-list-people-refuse-coronavirus-vaccination.html

Spain to maintain a list of people who refuse coronavirus vaccinations

Tuesday, January 12, 2021 by: Ramon Tomey

https://www.naturalnews.com/wp-content/uploads/sites/91/2021/01/vaccine-blue.jpg


Spain to maintain a list of people who refuse coronavirus vaccinations

Tuesday, January 12, 2021 by: Ramon Tomey
Tags: badhealth, badmedicine, badscience, coronavirus, covid-19, EU, European Union, France, Medical Tyranny, pandemic, Spain, vaccines
Bypass censorship by sharing this link:
New
https://www.hangthecensors.com/485879.html
Copy URL
2,520Views
Image: Spain to maintain a list of people who refuse coronavirus vaccinations

(Natural News) Spain has said it would list down the names of people who refuse to be vaccinated against the Wuhan coronavirus (COVID-19). In a Dec. 28 interview with broadcaster La Sexta, Spanish Health Minister Salvador Illa said the list of individuals who refused vaccination would be shared with other “European partners,” but clarified that it would not be made public or shared with employers.

“What will be done is a registry … [to] be shared with our European partners … of those people who have been offered [the COVID-19 vaccine] and have simply rejected it,” Illa said. The health minister also noted that the list “is not a document which will be made public” and the data in it will be “treated with the utmost respect for data protection.”

Illa mentioned that the list was aimed at ensuring that there were no errors in the system and that any person gets the opportunity to be immunized against COVID-19.

“The way to defeat the virus is to vaccinate all of us, or the more the better,” he added. Spanish citizens receive the COVID-19 vaccine on a voluntary basis.

Spanish authorities later clarified to Deutsche Presse-Agentur that the register of people who rejected the COVID-19 vaccine was only meant to collect clinical data. Only those who showed up for immunization and then rejected it would be registered in the list, the Spanish authorities added. (Related: Vaccine industry pushing state laws to TRACK your “vaccine status” with pharma surveillance tactics – urgent action needed.)

The health minister’s announcement came amid mass COVID-19 vaccinations in the country. Ninety-six-year-old Guadalajara nursing home resident Araceli Hidalgo was the first person in the country to receive the coronavirus jab Dec. 27. A 48-year-old worker at the nursing home where Hidalgo lived was the second person to be inoculated.

Up to 20 million Spaniards are expected to receive the coronavirus jabs by June 2021, less than half of the country’s 47 million total population.
Other European countries appear to be following Spain’s example

According to a poll by the Belgian state-funded Centre for Sociological Research, the number of respondents hesitant to take a COVID-19 vaccine dropped to 28 percent in December 2020 from 47 percent the previous month. The same poll also found that 40.5 percent of respondents were willing to have the vaccine. Meanwhile, 16.2 percent of respondents would avail of the vaccine if it is shown to be reliable.

Spain offers the COVID-19 vaccines for free as of writing, with the Spanish health service contacting those eligible to receive the first dose of the Pfizer/BioNTech vaccine approved by the European Medicines Agency.

Spain’s neighbors in the European Union have also put forward similar ideas of tracking their citizens for vaccination.

France is seeking to establish a registry of vaccinated citizens, alongside their health conditions. But this campaign is off to a slow start as officials look to build trust in the system. Polls in the country reflect utmost skepticism towards vaccination, with less than half of the French populations intending to get vaccinated. (Related: Americans to be issued vaccination record cards after receiving the coronavirus jab.)

On Twitter President Emmanuel Macron stated that vaccination will not be mandatory in France.

“I’ve said it before and I’m repeating it: The vaccine won’t be compulsory,” he said. “The cost of the vaccine is completely covered. There are no charges. Let’s be proud of our health system.”

Austria will roll out an electronic vaccination certificate where both patients and authorities can store vaccination records in the first quarter of 2021, Health Minister Rudolf Anschober told journalists in the capital Vienna. He added that the country plans to bolster its COVID-19 vaccination efforts with an information campaign.

Anschober remarked: “We won’t convince fierce anti-vaxxers, but I do see many who are undecided.”

Based on data from Johns Hopkins University, Spain currently has a 1.8 million COVID-19 caseload with 150,376 recoveries and 50,442 deaths. France has 2.6 million COVID-19 cases with 197,726 recoveries and 64,204 deaths. Meanwhile, Austria registered 355,352 COVID-19 cases with 328,974 recoveries and 6,059 deaths.

Visit Pandemic.news to learn more about vaccination efforts by other countries against the Wuhan coronavirus.

Sources include:

TheEpochTimes.com

FoxNews.com

DW.com

Euronews.com

Bloomberg.com

Dachsie
14th January 2021, 01:21 PM
https://www.bitchute.com/video/QEf7UpjuS5X7/

https://static-3.bitchute.com/live/cover_images/Rbtrop3rRlZl/QEf7UpjuS5X7_640x360.jpg

The New Normal // Documentary

1 hour video runtime

First published at 17:11 UTC on January 14th, 2021.

channel image

Jim Fetzer

Jim Fetzer

2969 subscribers

EXCELLENT new English documentary on the totalitarianism being imposed upon us under the pretext of there being a “viral pandemic:” HIGHLY RECOMMENDED!

https://odysee.com/@OracleFilms:1/New-Normal---Happen-Network:3 (53:12)

https://happen.network/

Dachsie
14th January 2021, 02:45 PM
This is what the Moderna "Covid 19" vaccine did.
This is Satanic EVIL.

______________

https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-january-14-2021

Watch this 18.19 minute video.

It should break your heart. Pray for the two people who shared their pitiful condition with us.

Dachsie
15th January 2021, 06:41 AM
Dachsie: See post # 836 of yesterday in this thread to see what happens to the human body when assaulted with this witches' brew, Moderna Covid 19 vaccine. Permanent devastating neurological damage to inflict permanent total disability.

____________________________




https://thefreedomarticles.com/not-a-vaccine-mrna-covid-vaccine-chemical-pathogen-device/


The mRNA COVID Vaccine is NOT a Vaccine
Published 6 hours ago on January 14, 2021
By Makia Freeman


AT A GLANCE...


THE STORY:The new mRNA COVID vaccine deployed by Moderna and Pfizer is not what you think. It's not a vaccine.

THE IMPLICATIONS:These so-called vaccines are chemical devices that make you sick, operating systems that reprogram your DNA forever, and much more.

https://397145-1250082-raikfcquaxqncofqfm.stackpathdns.com/wp-content/uploads/2021/01/SheepSheperdsGoatLargeA%CC%82%C2%A9JordanHenderson-768x471.jpg



NOT a Vaccine: the mRNA COVID vax is a chemical pathogen production device and a technocratic, transhumanistic tool to repgrogram you. Image credit: Jordan Henderson

It’s NOT a
vaccine. The mRNA COVID vaccine
now being militarily deployed in many nations around the world, is NOT a vaccine. I repeat: it is not a vaccine. It is many things indeed, but a vaccine is not one of them. We have to awaken to the fact that the COVID scamdemic has rapidly accelerated the technocratic and transhumanistic aspects of the New World Order (NWO) to the point where people are blindly lining up to get injected with a “treatment” which is also a chemical device, an operating system, a synthetic pathogen and chemical pathogen production device. As covered in previous articles (https://thefreedomarticles.com/10-things-to-know-experimental-covid-vaccines/), this new COVID vax is a completely new kind of technology, potentially even more dangerous than your average toxic vaccine. In this article, we will explore in more depth what this mRNA vaccine is.
Doctors David Martin and Judy Mikovits Expose How So-Called COVID Vaccine is Not a Vaccine Listen to this short excerpt (https://www.bitchute.com/video/6LYagqLH5SGa/) featuring doctors David Martin and Judy Mikovits (who have both been very outspoken thus far in exposing the COVID plandemic) who are speaking with Robert Kennedy Jr. and lawyer Rocco Galati, who is representing a Canadian freedom group suing the government for the entire COVID scam. David Martin makes some extremely important points about how we can’t accurately label the device Moderna and Pfizer are pushing as a vaccine, because both medically and legally, is not a vaccine:

“This is not a vaccine … using the term vaccine to sneak this thing under public health exemptions … This is a mRNA packaged in a fat envelope that is delivered to a cell. It is a medical device designed to stimulate the human cell into becoming a pathogen creator. It is not a vaccine! Vaccines actually are a legally defined term … under public health law … under CDC and FDA standards, and a vaccine specifically has to stimulate both an immunity within the person receiving it, but it also has to disrupt transmission … They have been abundantly clear in saying that the mRNA strand that is going into the cell is not to stop transmission. It is a treatment. But if it was discussed as a treatment, it would not get the sympathetic ear of public health authorities, because then people would say “What other treatments are there?”
The use of the term vaccine is unconscionable … because it actually is the sucker punch to open and free discourse … Moderna was a started as a chemotherapy company for cancer, not a vaccine manufacturer for SARS … if we said we’re going to give people prophylactic chemo for the cancer they don’t have, you’d be laughed out of a room, because it’s a stupid idea. That’s exactly what this is! This is a mechanical device, in the form of a very small packet of technology, that is being inserted into the human system to activate the cell to become a pathogen manufacturing site.
The only reason why the term [vaccine] is being used is to abuse the 1905 Jacobsen case that has been misrepresented since it was written. If we were honest with this, we would actually call it what it is: it is a chemical pathogen device, that is actually meant to unleash a chemical pathogen production action within the cell. It is a medical device, not a drug, because it meets the CDRH [Center for Devices and Radiological Health] definition of a device.
It is made to make you sick … 80% of the people who are exposed to allegedly the virus [SARS-Cov-2] have no symptoms at all … 80% of people who get this injected into them have a clinical adverse event. You are getting injected with a chemical substance to induce illness, not to induce a[n] immuno-transmissive response. In other words, nothing about this is going to stop you transmitting anything. This is about getting you sick, and having your own cells be the thing that get you sick.”
Judy Mikovits also chips in with this:

“It’s a synthetic pathogen. They’ve literally injected this pathogenic part of the virus into every cell of the body … it can actually directly cause multiple sclerosis, Lou Gehrig’s disease, Alzheimer’s disease … it can cause accelerated cancer … that’s what the expression of that piece of virus … has been known to do for decades.”

https://397145-1250082-raikfcquaxqncofqfm.stackpathdns.com/wp-content/uploads/2021/01/software-of-life-1024x400.png

COVID Vaccine is an Operating System, Says Moderna The COVID mRNA Vaccine is an operating system which can program your DNA, and therefore program you, at your core essential blueprint level. Is this an exaggeration? No it’s not. Moderna states on their website that their mRNA technology platform is a “software of life” and “functions very much like an operating system on a computer.” This is straight from their website (https://www.modernatx.com/mrna-technology/mrna-platform-enabling-drug-discovery-development):

“It is designed so that it can plug and play interchangeably with different programs. In our case, the “program” or “app” is our mRNA drug – the unique mRNA sequence that codes for a protein.”
The Game Plan: Making Every Human into a Digital Node on the Control Grid We are fast moving into the world of transhumanism, where our natural biological bodies are hijacked and infiltrated with synthetic parts, starting at the nanoparticle level. The NWO controllers want to download some kind of Microsoft office system or software into your body and brain, and hook you up to the JEDI and/or Amazon-CIA cloud, so they can have direct access to your brain. Then, they can roll out “vaccines” which are not vaccines to continually update you, just like computer software gets regular updates. Viruses, real or not, and vaccines, real or not, are just means to achieve this goal.
Turning Humans into Commodities via Social Credit Currency Alison McDowell sums up the current transhumanistic NWO path of highest probability below, which involves social credit, 5G, the Smart Grid and AI to induce planetary-wide compliance:


“Within the tech-no-logic system, total compliance will be demanded. Approved behavior becomes currency, tokenized on blockchain and monitored by sensors and AI. They are training us for a future where we compete with one another to see who is the best behaved, the most docile. Surviving will mean conforming to the strident terms of psychopathic financial agreements. To obtain the data needed to verify claims embedded in twisted “pay for success” deals, our mother, the earth, must be remade as a geo-fenced digital prison using 5G and satellite constellations. All of your data will be added to your “permanent record” to evaluate your value as human capital for investor portfolios. The billionaires envision a future where freedom is a privilege limited to themselves, their functionaries, and the robots they control. Be assured AI is already keeping tabs, and social credit scoring is well underway.”
It is a grim future, however it is not set in stone. I agree wholeheartedly with McDowell that we do NOT have to accept this as our fate or experience such a painful timeline IF we can wake up quickly and change. However, we must first accept this is the probable path we are on. Like it or not, this is the current trajectory. How do we change it? Firstly by looking within. To change ourselves, we must change our inner world and change our perception, and so therefore change our reality:

“This planned future, however, is NOT preordained. Totalitarian transhumanism is not a foregone conclusion. Trudell’s remedy? Change our perception of reality through active non-cooperation. Manifest in our hearts, minds, and actions the world we desire. Where they engineer disconnect, RECONNECT with intention; not only with one another, but with ALL our relations and the land and the spiritual beings that exist beyond our senses. We must synchronize to change the vibrational reality, and that power exists within us as children of the earth.”
This is not airy-fairy talk, but rather a realization that we are participating in co-creating a nightmare world by allowing our perception to be programmed to bring about the NWO. They are using our energy to do it! To reclaim our sovereignety, we must reclaim our perception by breaking down the programming that was inserted into us.
Final Thoughts: A Technocratic, Transhumanistic Tool It is vital to know, and to tell others, that the current mRNA COVID vaccine is not a vaccine. This is not just because calling it a vaccine gives Big Pharma legal immunity from damages, but also for all the reasons listed above. These devices are designed to reprogram you at the fundamental level. They are not vaccines, they are not drugs, and in my opinion, they are not treatments or medicine. As scary as these terms are, I would go beyond just calling them chemical devices, operating systems, synthetic pathogens and chemical pathogen production devices, which are already illuminating terms and horrible enough. I would call them technocratic, transhumanistic tools to permanently change your genetics and transform you into a synthetic human. They are symbolic of just how swiftly the NWO agenda is being made manifest in our physical reality, and hopefully a wake-up call to everyone to strive harder to stop this dark, nefarious agenda while there is still time.

keehah
15th January 2021, 08:32 AM
TheLocal.no: What's the latest on Norway's Covid-19 vaccine rollout? (https://www.thelocal.no/20210111/whats-the-latest-on-norways-covid-19-vaccination-programme)

11 January 2021

In two weeks, Norway has vaccinated 20,846 people with the Pfizer/BioNTech vaccine...

Data from last week collated by Our World in Data indicated that Norway had vaccinated 0.2 percent of its population.
The Norwegian Medicines Agency: Covid-19 vaccination associated with adverse drug reactions in elderly people who are frail (https://legemiddelverket.no/nyheter/covid-19-vaccination-associated-with-deaths-in-elderly-people-who-are-frail)

Publisert: 15.01.2021

As of 14 January, 23 reports of suspected deaths have been submitted to the Norwegian ADR health registry. The figures in the published report include the thirteen reports that have been assessed by the Norwegian Medicines Agency and the National Institute of Public Health. Several reports of suspected adverse reactions are received on a daily basis and are continuously assessed.

https://covid19.who.int/region/euro/country/no

In Norway, from Jan 3 to 12:50pm CET, 15 January 2021, there have been 56,614 confirmed cases of COVID-19 with 509 deaths.

WaPo/Associated Press: Norway adjusts advice after vaccine deaths but isn’t alarmed (https://www.washingtonpost.com/world/europe/norway-adjusts-advice-after-vaccine-deaths-but-isnt-alarmed/2021/01/15/d69cfa84-572d-11eb-acc5-92d2819a1ccb_story.html)

Jan. 15, 2021

COPENHAGEN, Denmark — Norwegian officials have adjusted their advice on who gets the COVID-19 vaccine in light of a small number of deaths in older people, leaving it up to each doctor to consider who should be vaccinated.

The Norwegian Medicines Agency on Thursday reported a total of 29 people had suffered side effects, 13 of them fatal. All the deaths occurred among patients in nursing homes and all were over the age of 80

keehah
15th January 2021, 05:48 PM
So Norway has 509 deaths labeled covid (wiki (https://en.wikipedia.org/wiki/COVID-19_pandemic_death_rates_by_country)). In a population of 5.32million that is a 0.00957% death rate over several months.

And Norway has 13 deaths labeled covid vaccine. In a vaccinated population of around 21 000 that is a 0.0619% death rate in a few weeks.

Yes the first vaccines were given to at risk people, and many covid cases are asymptomatic or otherwise not counted.

But overlooking such technicalities are about same standards as mainstream corporate media uses, so 0.0619/0.00947 = 6.47

THE COVID VACCINE IS 6.25 times MORE DEADLY THAN COVID!!!!!

So whatever Norway is doing to stop the spread of covid, seems they should be doing 6.25 times more to stop covid vaccinations.

If only 20% (including asyptomatics) get corona virus infection each year that is 0.0478% death rate

THE COVID VACCINE IS 1.27 times MORE DEADLY THAN COVID!!!!!


While this result is factually accurate data, I calculated and posted this as a MSM, government and vaccine company shaming troll.
Not worthwhile health data.
More data is needed before attempting to speculate on the truth of this matter.


To more precisely compare the two death rates consider: Is the infection ate much lower than 20%, I’ve seen this number used officially before for the flu.
Exposure (vaccination) was only to at risk groups (unlike with cold virus exposure in general population, but like with covid deaths were old)
The deaths are not 'caused by', but 'contributed to (like with covid)
Perhaps the actual vaccine number is lower than 13 (like with covid test 80% false positive)
Perhaps they would have died this year anyway (like with covid)

Dachsie
15th January 2021, 06:28 PM
All statistics have been lies from the beginning. This scam was cover to bring in the economic reset. The vacine does not prevent one from getting the flu and it does not prevent one from spreading the flu. The seasonal flu strain changes every year so flu shot is always a year behind. Its only effect is to give you a bad case of the flu. But this "vaccine" changes your genetic code. I do not want to explain the insanity of taking this shot. It is all so incredibly evil and nonsensical.

Even frontline medical care providers do not want to take the vaccine and some institutions are offering to pay them to get the shot. If they choose to permanently mutilate their bodies, they will become a chronically ill person with a growing number of autoimmune conditions.

For a Christian, this vaccine may not technically be the mark of the beast but it certainly opens the door to getting your body ready for this exact same kind of satanic advancing technology.

PatColo
16th January 2021, 08:29 AM
Cynthia McKinney RT'd this; 1m 48s clip inside, re what's 'scheduled' for next week -- "You know what's going on by now..."
https://twitter.com/SovMichael/status/1349801679634522115



For your information:
A nurse in Broward County, Florida.

PatColo
16th January 2021, 08:49 AM
I'll just post the occasional above-average 'rona vid/podcast here -- it's a 'superior' thread coz Dachsie didn't post it under "General Discussion" which, AFAIK, is the only subforum which prohibits posting images! :rolleyes:

Tim & Joe's Sat show (recorded Fri's) is already posted; find them all at
https://tkelly6785757.podomatic.com/

PatColo
16th January 2021, 09:21 AM
Tim & Joe's Sat show (recorded Fri's) is already posted; find them all at
https://tkelly6785757.podomatic.com/

^ listening to this now; @ ~50m Joe tells the story of Schumer getting heckled by a really articulate woman on the street in NYC - here's a 2m 20s clip of that:
https://twitter.com/jacobkornbluh/status/1349073414456291333

it could actually really use subtitles -- often hard to understand her with her face diaper muffling her like that

Dachsie
16th January 2021, 09:23 AM
Cynthia McKinney RT'd this; 1m 48s clip inside, re what's 'scheduled' for next week -- "You know what's going on by now..."
https://twitter.com/SovMichael/status/1349801679634522115



For your information:
A nurse in Broward County, Florida.

"You know what's going on by now."

This whole corrupt system needs to be taken down right now. What's going on is eugenics, population control, Dr. Josef Mengala style. One world death and slavery system for all.

There is going to be a "covid crisis" next week that will necessitate this hospital in Broward County Florida giving up post surgery recovery room space to this satanic "covid" deception scheduled for next week.

God bless this brave woman who shared this important information. Pray for her. Lin Wood talks a big talk, but this humble health care provider DELIVERED.

This covid operation has been quite successful in causing thinking people to be totally distrustful of their doctor and their hospitals and medical care in general. Divide and conquer and get us all at odds with each other. Communist playbook 101

Dachsie
16th January 2021, 09:36 AM
^ listening to this now; @ ~50m Joe tells the story of Schumer getting heckled by a really articulate woman on the street in NYC - here's a 2m 20s clip of that:
https://twitter.com/jacobkornbluh/status/1349073414456291333

it could actually really use subtitles -- often hard to understand her with her face diaper muffling her like that

"Jacob Kornbluh
@jacobkornbluh
Heckler calls Schumer “an antisemite.”
"

refers to this wise woman as a "heckler".
Schumer is FILTH who worships THE FATHER OF LIES.

Just to be extra clear.

Pelosi and McConnell had total control and authority over the Capitol police on January 6, 2021 false orchestrated event of these evildoers. They should be arrested, given military trial. and meted out the harshest punishment for Treason and Sedition. Every tiny element of that staged Jan 6 event wreaks with falsity.

We the people hunger and thirst for justice because we love the One who is Truth.

PatColo
16th January 2021, 09:48 AM
God bless this brave woman who shared this important information. Pray for her. Lin Wood talks a big talk, but this humble health care provider DELIVERED.

^ me fears this Broward nurse will be losing her job soon -- that's what happened to at least one nurse in UK who vented about the BS. The nail sticking up gets the hammer -- but what if more & more vent publicly like this?!

It's a great show, like with the majority of hospital/med workers who are rejecting the jab -- what can the (((hoaxers))) do about that dilemma?! :D

PatColo
16th January 2021, 10:14 AM
I'll just post the occasional above-average 'rona vid/podcast here -- it's a 'superior' thread coz Dachsie didn't post it under "General Discussion" which, AFAIK, is the only subforum which prohibits posting images! :rolleyes:

Tim & Joe's Sat show (recorded Fri's) is already posted; find them all at
https://tkelly6785757.podomatic.com/


a note re Tim's Tue 1/12 show with guest Eric Karlstrom, found at link above -- I only made it through ~half of this. I've listened to plenty of Eric K over the past several years, mostly on Rense, ACHitchcock, Tim K, & I think even Spingola from ~7+ years ago when I could last tolerate her, pre-Sandy Hoax sellout.

Eric's "talent" for LOOOONG monologs where the show host can just mute, & go make themselves a snack, toilet run, refill coffee, whatever... kind of wear me down. I much prefer a 2 way dialog! Erik does seem to get it, the whole big picture, but being immersed in this stuff myself over the years, I find I don't learn much if anything new from him anymore. The odd times he speaks of something, some tech maybe, that I'm not already versed on -- it usually "rings true." But otherwise, Eric hits my ears as just another voice regurgitating the same message any more -- poor "signal to repetition ratio", you could say.

That's surely not true for newer listeners though, transitioning from normie-dom to red pilled, so I don't fault Eric making the rounds. I'll just tend to search out new voices instead, when I see he's back as guest du jour in my regular podcast circuit.


edit - AU's "Peekay Truth", a voice we don't hear from much anymore coz (((Muh Big Tech Censorship))), was on with Fetzer a couple days ago:

THE FETZ PRESENTS (14 JAN 21): PEEKAY FROM DOWNUNDER - THE CORONAVIRUS HOAX AND OTHER MASS ILLUSIONS (https://www.bitchute.com/video/hvPoeYdeWpMe/)

^ heh; "THE FETZ" is awfully close to stepping on the toes of Dennis "The Fetch" Fetcho

Dachsie
16th January 2021, 10:19 AM
Agree one hundred percent about Karlstrom. I wrote him one time and aksed a question. He replied by trying to sell me some of his music products.

PatColo
16th January 2021, 10:41 AM
^ lolz; that's gratifying to hear -- wasn't sure if I was being a stick in the mud re Karlstrom. He seems to be sort of an aggregator of other people's original work, making him like "Jack of all [conspiracies], Master of none." Well if I had to characterize my own 'hobby-ism" re conspiracies, that would describe me too! So, pot > kettle > black I suppose. I mostly just convey info back & forth re good info/shows, usu adding my own "intuition" thoughts.

Eric's long claimed to be a TI (Targeted Individual), but then oddly, I don't recall him ever detailing his own personal experiences with that, IE what EM weapons they've hit him with, what "street theater" experiences, what remedial steps he's taken etc. This is one area where he could really shine, bringing his unique story to the table, but he doesn't!

Instead he's on show after show, giving these motor-mouth/monolog regurgitations of other people's original research. Didn't he say his (former?) profession was being a history prof at a local community college?

Dachsie
16th January 2021, 10:54 AM
"Jacob Kornbluh
@jacobkornbluh

"
They should be arrested, given military trial. and meted out the harshest punishment for Treason and Sedition. "

_____________________________________________


"I believe in capital punishment so long as is ain't too severe."
Edith Bunker

Dachsie
16th January 2021, 02:13 PM
https://static-3.bitchute.com/live/cover_images/Rbtrop3rRlZl/ybnzP2q2AA97_640x360.jpg

51:58 video runtime

https://www.bitchute.com/video/ybnzP2q2AA97/

The Science of mRNA Vaccines - Dr. Tom Cowan

First published at 18:26 UTC on January 16th, 2021.

channel image

Jim Fetzer

Jim Fetzer

3125 subscribers

EXTREMELY GOOD explanation of RNA, DNA and mRNA and how the functions of those elements of cellular biology will be impacted by the synthetic mRNA vaccines being rolled out. Dr. Tom Cowan, a “visionary” medical thinker, takes on the subject of the new mRNA “vaccines.” He spells it ‘vacations’ in order to avoid YouTube censorship. He also refers to a vaccine as a ‘vacation’ in the video for the same reason.

PatColo
16th January 2021, 03:41 PM
I'll just drop this here...

Episode 393 – The 4th Annual Fake News Awards! (https://www.corbettreport.com/fakenews4/)

Corbett (https://www.corbettreport.com/author/admin/) • 01/16/2021 • 17 Comments (https://www.corbettreport.com/fakenews4/#comments)

monty
16th January 2021, 09:33 PM
http://enformtk.u-aizu.ac.jp/howard/fuellmich/

— title: Fuellmich's newsletter of Jan 6, 2021 layout: reports —
Newsletter 355, 06.01.2021: Money Talks VI and the worldwide lawsuits

(this is an ad-hoc translation by Paul Charles Gregory BDÜ of the original German text by Dr. Reiner Fuellmich)
Table of Contents:


Status of the PCR lawsuit at the Regional Court of Berlin
Lawsuit on PCR test submitted in New York
Portugal and Ecuador show Germany who the real banana republic is
Canada submits first class action suit for compensation which will be an international class action
Further points: Lawsuit against the EU Commission for its approval of the vaccine to be declared null & void; constitutional complaint lodged against the measures by a German judge

Ladies and Gentlemen,
Despite everything, or indeed in view of everything, let us first wish you all a cheerful New Year for 2021. Before we inform you about the state of play of the Corona lawsuits, and in particular the class actions, here is a reminder of the background against which all this is happening:
The hearings conducted by the Berlin Corona Committee since July 10, 2020, and attended by some one hundred internationally prominent scientists, medics, economists, lawyers and people badly affected, have determined – as of today – that at no point was the Corona scandal about health. This is because:


As explained in the last newsletter, the danger presented by this allegedly new virus can be compared to that of influenza – this is the conclusion not only of studies by Prof. John Ioannidis of Stanford University but also the assessment of the World Health Organisation.
The Drosten-PCR-Tests, which were devised in January 2020, are not remotely suitable for determining whether someone is infected or not, despite being recommended as the global Gold Standard for determining infection by the WHO; it should be noted that the leadership of this organisation is under the financial control of China and the Bill & Melinda Gates Foundation (the WHO certainly has good employees – as too does the Robert-Koch Institute, despite its incompetent management).

In a retraction paper, a score of highly regarded international scientists have called on the editors of the journal which published the PCR tests as a measurement method for infections to withdraw the mischief forthwith. This test is not only scientific nonsense, but was obviously designed to create as many false positives as possible and so spread panic in the world. This English language retraction paper has been viewed about 18 million times:
www.cormandrostenreview.com (http://www.cormandrostenreview.com/)

Furthermore, a second assertion made in January 2020 by Drosten that there are asymptomatic infections is false. These do not exist, as documented most recently by a major survey of ten million people from Wuhan of all places:
https://doi.org/10.1038/s41467-020-19802-w (https://doi.org/10.1038/s41467-020-19802-w)

A person who has no symptoms is healthy. This means that no-one need be fearful of people without symptoms or force them to wear masks, and no-one must be frightened that a positive test means that the person who has tested positive is infected. Horror pictures of hospitals with beds in the corridors are again doing the rounds – such scenes occur every year during a completely normal influenza outbreak (we will be glad to make available a kaleidoscope with such pictures of recent years taken from the mainstream media): such pictures are used solely in order to spread panic. There is still no excess mortality in Germany – it is perfectly normal for more people to die in winter.

So what is really at issue, if there is no health problem different to the normal surge of influenza? Here, too, we have been able to form an impression from the hearings we have conducted and from more ancillary information.

As of today, it must be assumed that, in September 2019, the Davos clique, as we call them, was about to go up in smoke. This group of self-appointed corporate elites and top politicians has met annually for at least 20 years under the auspices of the World Economic Forum (WEF), which is a private organisation. What happened was that, in September 2019, there was a further financial crash, even bigger than that of the Lehman crisis 12 years ago. This was reported on only briefly (by, among others and very competently, the German weekly broadsheet Die Zeit), after which the reporting went silent again. The financial system was again on the brink of collapse because there was a menace of it becoming visible that, for at least 20 years, its sole purpose had been to plunder the taxpayers to the benefit of the Mafia-like operations. In other words: to shift the assets of the broad mass of citizens to business concer ns. The best example of this are the ‘Cum-ex deals’, which are still unpunished, with the help of which banks, concerns and the super-rich were reimbursed twice or three times for taxes that they had paid just once. It is understandable that it might be possible to have reimbursed a tax payment of € 10 million. But not that instead, 20 or 30 million can be demanded back – this is something that everyone will find obvious, with or without a degree in law. This way the above-mentioned insiders obtained over many years a total of € 38 billion by defrauding the taxpayers. This was only possible because they were given cover by politicians – who over at least the last 20 years in particular have been made compliant by the relevant elites through the private WEF meetings. The fact that the courts in Germany failed to act shows that those mentioned are able, via the political scene, to influence what happens in the courts.

We had long seen that something was amiss during our lawsuits about bank liability in connection with finance for dilapidated buildings. For there, too, it emerged that Deutsche Bank in particular had a direct line to the courts and had made the judges into errand boys without a mind of their own. (Incidentally, the former head of Deutsche Bank, Josef Ackermann, not only met Merkel & Co regularly in Davos but celebrated his sixtieth birthday directly in the chancellory with Merkel.) This explains why German judges – blindly – adopted in their pronouncements the assertion of Deutsche Bank that it was normal for a bank to issue loans without a loan agreement in the hope that, sometime later, it would be possible to conclude a suitable loan contract; the thinking being that the issue of a loan at the request of a potential borrower leads to a loan contract being concluded, yet since, at this time, Deutsche Bank did not have the documents necessary for a valid contract, it was not possible for a court to determine that a contract had come about merely by the funds being made available – because if it had, the Deutsche Bank would have sunk like a stone – except that none of us had imagined that the Deutsche Bank was only one part of the Davos clique, albeit a most important member for purposes of money laundering, and that today we have to reckon with a thoroughly corrupt elite which will stop at nothing.

In his report “Pandemic Games”, Paul Schreyer has described very lucidly this entanglement of corporate “elites” and political “elites,” which has become ever deeper over the last 20 years. There he also illustrates how these elites have been attempting, in a targeted and practised manner, not only to retain illegitimate power but even to extend such power indefinitely with the aid of the most massive and cynical control mechanisms before the objects of these control mechanisms – which is us – can notice and rebel against it.

https://www.youtube.com/watch?v=SSnJhHOU_28 (https://www.youtube.com/watch?v=SSnJhHOU_28)

In his lecture “Why do the lambs not speak up,” Professor Rainer Mausfeld explained in turn (incidentally, already at the beginning of 2019 and so entirely independently of the Corona story) how over many years politics has repeatedly manufactured fear and panic, without the general public realising what was happening, in order to get people to support political decisions which they would otherwise reject.
https://www.youtube.com/watch?v=-kLzmatet8w (https://www.youtube.com/watch?v=-kLzmatet8w)

The former US deputy minister of housing construction and investment banker Catherine Austin Fitts explains in her documentary film “Catherine Austin Fitts Full Interview Planet Lockdown” how these “elites” are currently implementing the takeover of the assets of the middle classes or are trying to (because if only 10% of the population notice this, the house of cards will collapse, some thinkers assume an even lower percentage). With the focus here on the USA, but certainly applicable to elsewhere, one of the ways in which this is happening is that, first of all, areas with small and medium-sized businesses, for example restaurants and retailers, are closed via Lockdown so that their owners can no longer make a living, and in particular that they can no longer pay back any loans they have taken out. Although aid packages are announced, these are disbursed only sparingly if at all. Thereafter – and this may apply specifically only to the USA – riots are organised in these areas, which lead to the additional destruction of these businesses so that they can no longer be sold even in a fire sale. Thereafter, investors with tax breaks and from the aforementioned Davos clique can acquire these businesses for next to nothing.

Link to interview with Catherine Austin Fitts (https://thewallwillfall.org/2021/01/07/catherine-austin-fitts-planet-lockdown/)

On the lawsuits

As you will know, a number of institutions and law firms have coordinated worldwide in order to have the courts ascertain the background illustrated above and in order afterwards to demand compensation from the ringleaders and concerns for the many who have been harmed by the Drosten-Test lockdown.

The lawsuits being pursued globally are not uncoordinated – they are largely the result of detailed joint planning by the scientists and lawyers involved. The two facts (i) that the Drosten-Test recommended globally by the WHO cannot detect infection, and (ii) that there are no asymptomatic infections (and therefore no real pandemic, at most a PCR casedemic) are of central importance for the outcome of the lawsuits. These facts will cause the house of cards of the pandemic fraudsters to collapse everywhere.

It also follows that whatever is established in the USA, Canada, Australia, Italy, France etc. in this context, (using the help of witnesses and experts, as well as expert opinions) can also be used as evidence in all other courts of the world.

I. Our PCR test complaint on behalf of Dr. Wodarg and the complaint against Drosten and subsequent complaints

The complaint is pending at the Regional Court of Berlin under the file number 27 O 436/20. On account of an “oversight” – which we consider very strange – the complaint was only delivered to the opposing party weeks after its submission. It was alleged that the court fees which we had remitted had erroneously been booked as payment for a final settlement of accounts and only when – after our phone call – this "oversight" was put right was the complaint formally delivered. We are now waiting for the opposing party to reply.

The complaint against Drosten is based on the Cease-and-Desist letter to Drosten:
http://bit.ly/3rcnWlB (http://bit.ly/3rcnWlB)

(Original German version: http://bit.ly/3nrn62b (http://bit.ly/3nrn62b) )

The complaint will be completed in the coming days and then, it too, will be submitted to the Regional Court of Berlin. Together with a group of lawyers we are working on a number of further precedence case complaints, but above all (because this is faster and less expensive) also on many cease and desist letters against those in positions of responsibility. This way we obtain in effect something like a German class action. The cease and desist letters ensure that the visible puppets Drosten, Wieler, but also the members of The Leopoldina National Academy of Sciences and others including the individuals who, in their official capacities, bear personal responsibility for imposition of quarantine and similar measures – the cease and desist letters ensure that these people are put under pressure even if, thereafter, the necessary justification of the claims arising from the letters will need many months. In this time, a few of the precedence case lawsuits (which all concern the PCR tests and asymptomatic infections) will proceed by taking evidence (i.e. questioning of ordinary and expert witnesses and the drafting of expertises). Their results can then be used for rulings on the parallel “dormant” proceedings: the lawsuits dormant until this point of time will not be able to come to any other conclusion since the facts will have been established in the parallel precedence cases.

II. PCR test lawsuit in New York

On December 16, 2020, the US colleagues working with Robert F Kennedy, Jr´s Children’s Health Defense and advised by the same experts as ourselves, submitted a PCR test complaint in New York on behalf of a number of plaintiffs.

Translator’s note: Supplementary information describing the PCR test complaint will be issued shortly as an update to this translation.



III. The Canadian class action, which will develop to be an international class action for all those harmed by the Drosten-PCR-Test-Lockdowns

In the last week Canadian colleagues working with Michael Swinwood have submitted a class action. It is being added to, on the instructions of the court. The complainants initially represented are Indians, a group of small business people and a representative of disabled people. In contrast to all complaints submitted to date, this complaint narrates briefly the historical background of the power structures behind the Davos clique which have been constructed over the course of centuries.

Translator’s note: Supplementary information describing the class action will be issued shortly as an update to this translation.



The Indians (Algonquin) as a complainant group are of special significance since they – together with the Indians of the USA and Latin America – have for centuries been the object of attempted genocide by the conquerors. In the words of Michael Swinwood, “We are all Indians now.”

IV. Court rulings from Portugal and Ecuador



Some weeks ago, an appeal court in Portugal ruled that the PCR tests are not able to ascertain infection let alone illness, which is exactly what the inventor of the PCR tests, the Nobel Prizewinner Kary Mullis repeatedly emphasised - At is sue was the case of four German tourists, one of whom had tested positive, and all of whom the authorities had placed under what the court determined to be a kind of house arrest – similar to the action of German administrative courts who follow blindly German fake science; thereby the appeal court confirmed an earlier finding that the quarantine was unconstitutional.

This judgement is a slap in the face for the German administrative courts, which were forced to concede that PCR tests cannot ascertain the presence of infection but nonetheless – in a case of crass perversion of justice – imagined that they had to follow the instructions of the Robert Koch Institute in its reliance on PCR tests and assumed that the healthcare system was on the brink of being overwhelmed (e.g. Higher Administrative Court Münster) – in this respect the Portuguese judgement demoted the German administrative courts to the status of banana republic. This is the shape of lessons in the rule of law by a Portuguese for a German court (the judgement linked to is in Portuguese so may need professional or machine translation).

Translator’s note: this english language report on the Portugal case was not included in the Fuellmich newsletter but has been added here to provide further background on the judgement.http://cognitive-liberty.online/portuguese-court-rules-pcr-test-as-unreliable/ (http://cognitive-liberty.online/portuguese-court-rules-pcr-test-as-unreliable/)




A judgement pronounced on January 2, 2021, by the Constitutional Court of Ecuador ruled that all anti-Corona measures to date are based on mere conjectures without any basis in fact. After nine months it should finally be possible for the acting politicians to communicate clear, evidence-based assertions and base their measures on these. But since this has not happened, all the measures are unconstitutional. Below is the link to the judgement (we shall publish the judgement itself in the original on the website of the Corona Committee).

https://ricapod.buzzsprout.com/1409218/7133344-verfassungsgericht-kippt-ausnahmezustand-wir-machen-auf?fbclid=IwAR2xBQvUz63NMA3VGglPOxC2UCy3Fxfh_tveV RsBUSwFmLkdnsrdCYCwTao (https://ricapod.buzzsprout.com/1409218/7133344-verfassungsgericht-kippt-ausnahmezustand-wir-machen-auf?fbclid=IwAR2xBQvUz63NMA3VGglPOxC2UCy3Fxfh_tveV RsBUSwFmLkdnsrdCYCwTao)

Not one of the German administrative courts ruling on urgent injunctions nor indeed the Federal Constitutional Court have made any such pronouncement for Germany although of course the finding applies equally for Germany. This is a lesson from an Ecuadoran Court in the rule of law for the German courts.

V. Lawsuit to declare void vaccine approval; constitutional complaint by a German judge against the measures of a Federal Government which has practically been kidnapped by the Davos Clique – measures which are destroying democracy and the rule of law



Parallel to all these efforts, the Italian lawyer Dr. Renate Holzeisen is working with us and experts on a lawsuit against the EU Commission to have its approval of vaccines declared null & void – vaccines which are de facto untested and highly dangerous – in the case of the manufacturers Bioentech/Pfizer and Moderna, these are prohibited genetic experiments on humans. Meanwhile, the superbly versed and hard-hitting anti-Mafia public prosecutors are investigating the WHO and its Italian backers. In France work is progressing on a complaint to the Court for Human Rights.
A German judge (who we are in contact with) has submitted a constitutional complaint against the blanket measures of the Federal Government, these measures undermining democracy and the rule of law; the hope here is that – notwithstanding all concrete appearances – the head of the Constitutional Court has retained his independence. We have published these constitutional complaints on our news website and they can be submitted by anyone.

https://2020news.de/wp-content/uploads/2020/12/Verfassungsbeschwerde-Richter-anonym-30122020.pdf (https://2020news.de/wp-content/uploads/2020/12/Verfassungsbeschwerde-Richter-anonym-30122020.pdf)

We shall continue to keep you up to date about the legal developments, including with vide os (although here there is a danger of them being removed from the platform). At the same time we must work on making the true facts known to as many people as possible. We will win because we must win.

Best regards
Dr. Reiner Fuellmich, LL.M.
- Attorney –

PS: With developments in the courts proceeding rapidly, and since we shall probably partic ipate with submissions of our own in at least one of the ongoing Anglo-American lawsuits, we intend in a fortnight to three week to conduct a Zoom conference for the clients we are representing; in this framework we shall discuss matters with some of the attorneys involved here and in the English-speaking countries and also with Professor Schwab; we shall also answer questions coming from the chat.

PatColo
16th January 2021, 10:05 PM
WOH!

U know all the speculation about what goodies the ~6" up the shnoz PCR test might be leaving behind (like, the MuhRONA itself?), besides the jeopardy of damage to the blood-brain barrier?

from 14:50 - 22m in this latest from Max today, woman (who suffers from Morgellon's) gets a couple of those tests & picks apart the "cotton" swab end, & finds they're actually 'living' Morgellon's nano-fibers -- she claims they're silver, not cotton! 42m:

BUCKLE UP! THE RIDE IS ABOUT TO BEGIN (https://www.bitchute.com/video/S3oqGf8VIhO8/)

Max's previous vid pub'd Jan 12, 36m:

The Covid Fraudemic - You Are the Resistance (https://www.bitchute.com/video/u2f7nav2NnfV/)

Dachsie
17th January 2021, 11:03 AM
The Same Playbook

There was a break-in of the Bundestag building in Berlin Germany on August 30, 2020, that happened at the time of huge, possibly million person, demonstration of the people against the Covid restrictions. The goal of this "storming" on the Bundestag appears to have been to draw attention away from the huge demonstration of the citizenry of Germany against the "Covid virus" restrictions on the people.

The January 6, 2021, entry of several "protesters" to the United States Capital building took place at the exact same time that congress was inside the same building about to hear testimony regarding the instances of massive voting irregularities and fraud related to the November 3, 2020 United States presidential election. The goal appears to have been to draw attention away from the strong evidence of vote fraud in several large U S cities.

The Bundestage parliament building probably is just a maximum security building as is also the United States capitol building in Washington D.C.

Same playbook.

Same fakery events.

Same paid crisis actor talent agency?

Same paymaster?

Same purpose.

Manipulate and control the populace to install a One World Death and Slavery System for All.
Use any old created atrocity -- virus, massive vote fraud etc -- as the tool to play out the problem / reaction /solution routine again and again.

_______________________________



https://www.dw.com/en/german-leaders-slam-extremists-who-rushed-reichstag-steps/a-54758246


News
German leaders slam extremists who rushed Reichstag steps

Politicians have hit out at extremists and corona-skeptics who attempted to enter Germany's parliament building after police shut down their demonstration. Hundreds of people were arrested.

https://static.dw.com/image/54755588_303.jpg


News
German leaders slam extremists who rushed Reichstag steps

Politicians have hit out at extremists and corona-skeptics who attempted to enter Germany's parliament building after police shut down their demonstration. Hundreds of people were arrested.

Deutschland Berlin Protest gegen Corona-Maßnahmen

German politicians on Sunday said they were outraged after several hundred people attempted to break into the Reichstag — the federal parliament building in Berlin — as part of a vast protest against the country's coronavirus restrictions.

President Frank-Walter Steinmeier described the incident as an "unbearable attack on the heart of our democracy."

On Saturday evening, hundreds of people tried to force their way into the building and were able to break through a security barrier and run up the stairs before being stopped by police.

Many of those involved sported clothing and flags associated with the far-right Reichsbürger movement, which denies the legitimacy of the modern German state.
'Extremist rabble'

Steinmeier labeled the trespassers a "right-wing extremist rabble," before paying tribute to security forces who he said had "acted extremely prudently in a difficult situation."

The incident took place after an estimated 38,000 people gathered in the German capital on Saturday to protest against the country's coronavirus policies.

After about two hours, police called off the protest, citing the disregarding of social distancing rules.

Reacting to the incident, Interior Minister Horst Seehofer told the newspaper Bild am Sonntag that: "The Reichstag building is the seat of our Parliament and thus the symbolic center of our liberal democracy."

"The fact that sowers of chaos and extremists are abusing it for their own purposes is unacceptable."

embedded video

Germany bans anti-Semitic 'Reich Citizens' group


News
German leaders slam extremists who rushed Reichstag steps

Politicians have hit out at extremists and corona-skeptics who attempted to enter Germany's parliament building after police shut down their demonstration. Hundreds of people were arrested.

Deutschland Berlin Protest gegen Corona-Maßnahmen

German politicians on Sunday said they were outraged after several hundred people attempted to break into the Reichstag — the federal parliament building in Berlin — as part of a vast protest against the country's coronavirus restrictions.

President Frank-Walter Steinmeier described the incident as an "unbearable attack on the heart of our democracy."

On Saturday evening, hundreds of people tried to force their way into the building and were able to break through a security barrier and run up the stairs before being stopped by police.

Many of those involved sported clothing and flags associated with the far-right Reichsbürger movement, which denies the legitimacy of the modern German state.
'Extremist rabble'

Steinmeier labeled the trespassers a "right-wing extremist rabble," before paying tribute to security forces who he said had "acted extremely prudently in a difficult situation."

The incident took place after an estimated 38,000 people gathered in the German capital on Saturday to protest against the country's coronavirus policies.

After about two hours, police called off the protest, citing the disregarding of social distancing rules.

Reacting to the incident, Interior Minister Horst Seehofer told the newspaper Bild am Sonntag that: "The Reichstag building is the seat of our Parliament and thus the symbolic center of our liberal democracy."

"The fact that sowers of chaos and extremists are abusing it for their own purposes is unacceptable."

Read more:Opinion: A coronavirus fiasco with one ray of hope


RANK
12:06 MIN.428 views
Sex and relationships during the COVID-19 pandemic
RANK
02:51 MIN.2.76K views
Coronavirus poses new dangers for sex workers
NEW
01:37 MIN.20 views
Getting vaccinated in England’s Salisbury Cathedral
HOT
04:44 MIN.156 views
Will Nord Stream 2 ever be completed?
HOT
04:13 MIN.108 views
New ideas for timeless shapes: Designer Stefan Diez
Germany bans anti-Semitic 'Reich Citizens' group
Nazi symbols 'have no place' near Parliament

Foreign Minister Heiko Maas tweeted: "It is shameful to have flags of the German Reich in front of Parliament."

______

Heiko Maas
����
@HeikoMaas
Alle haben Recht, über Umgang mit Corona zu streiten & natürlich für Ihre Meinung zu demonstrieren.

NIEMAND sollte dafür Rechtsextremen hinterherlaufen, PolizistInnen gefährden & viele einem Infektionsrisiko aussetzen.

Reichsflaggen vorm Parlament sind beschämend.

#Berlin2908
1:38 PM · Aug 29, 2020
5.3K
See the latest COVID-19 information on Twitter

______


News
German leaders slam extremists who rushed Reichstag steps

Politicians have hit out at extremists and corona-skeptics who attempted to enter Germany's parliament building after police shut down their demonstration. Hundreds of people were arrested.

Deutschland Berlin Protest gegen Corona-Maßnahmen

German politicians on Sunday said they were outraged after several hundred people attempted to break into the Reichstag — the federal parliament building in Berlin — as part of a vast protest against the country's coronavirus restrictions.

President Frank-Walter Steinmeier described the incident as an "unbearable attack on the heart of our democracy."

On Saturday evening, hundreds of people tried to force their way into the building and were able to break through a security barrier and run up the stairs before being stopped by police.

Many of those involved sported clothing and flags associated with the far-right Reichsbürger movement, which denies the legitimacy of the modern German state.
'Extremist rabble'

Steinmeier labeled the trespassers a "right-wing extremist rabble," before paying tribute to security forces who he said had "acted extremely prudently in a difficult situation."

The incident took place after an estimated 38,000 people gathered in the German capital on Saturday to protest against the country's coronavirus policies.

After about two hours, police called off the protest, citing the disregarding of social distancing rules.

Reacting to the incident, Interior Minister Horst Seehofer told the newspaper Bild am Sonntag that: "The Reichstag building is the seat of our Parliament and thus the symbolic center of our liberal democracy."

"The fact that sowers of chaos and extremists are abusing it for their own purposes is unacceptable."

Read more:Opinion: A coronavirus fiasco with one ray of hope


RANK
12:06 MIN.428 views
Sex and relationships during the COVID-19 pandemic
RANK
02:51 MIN.2.76K views
Coronavirus poses new dangers for sex workers
NEW
01:37 MIN.20 views
Getting vaccinated in England’s Salisbury Cathedral
HOT
04:44 MIN.156 views
Will Nord Stream 2 ever be completed?
HOT
04:13 MIN.108 views
New ideas for timeless shapes: Designer Stefan Diez
Germany bans anti-Semitic 'Reich Citizens' group
Nazi symbols 'have no place' near Parliament

Foreign Minister Heiko Maas tweeted: "It is shameful to have flags of the German Reich in front of Parliament."

"Nazi symbols and flags of the Reichsbürgers and of Imperial Germany have no place in the German Bundestag," wrote Finance Minister Olaf Scholz.


News
German leaders slam extremists who rushed Reichstag steps

Politicians have hit out at extremists and corona-skeptics who attempted to enter Germany's parliament building after police shut down their demonstration. Hundreds of people were arrested.

Deutschland Berlin Protest gegen Corona-Maßnahmen

German politicians on Sunday said they were outraged after several hundred people attempted to break into the Reichstag — the federal parliament building in Berlin — as part of a vast protest against the country's coronavirus restrictions.

President Frank-Walter Steinmeier described the incident as an "unbearable attack on the heart of our democracy."

On Saturday evening, hundreds of people tried to force their way into the building and were able to break through a security barrier and run up the stairs before being stopped by police.

Many of those involved sported clothing and flags associated with the far-right Reichsbürger movement, which denies the legitimacy of the modern German state.
'Extremist rabble'

Steinmeier labeled the trespassers a "right-wing extremist rabble," before paying tribute to security forces who he said had "acted extremely prudently in a difficult situation."

The incident took place after an estimated 38,000 people gathered in the German capital on Saturday to protest against the country's coronavirus policies.

After about two hours, police called off the protest, citing the disregarding of social distancing rules.

Reacting to the incident, Interior Minister Horst Seehofer told the newspaper Bild am Sonntag that: "The Reichstag building is the seat of our Parliament and thus the symbolic center of our liberal democracy."

"The fact that sowers of chaos and extremists are abusing it for their own purposes is unacceptable."

Read more:Opinion: A coronavirus fiasco with one ray of hope


RANK
12:06 MIN.428 views
Sex and relationships during the COVID-19 pandemic
RANK
02:51 MIN.2.76K views
Coronavirus poses new dangers for sex workers
NEW
01:37 MIN.20 views
Getting vaccinated in England’s Salisbury Cathedral
HOT
04:44 MIN.156 views
Will Nord Stream 2 ever be completed?
HOT
04:13 MIN.108 views
New ideas for timeless shapes: Designer Stefan Diez
Germany bans anti-Semitic 'Reich Citizens' group
Nazi symbols 'have no place' near Parliament

Foreign Minister Heiko Maas tweeted: "It is shameful to have flags of the German Reich in front of Parliament."

"Nazi symbols and flags of the Reichsbürgers and of Imperial Germany have no place in the German Bundestag," wrote Finance Minister Olaf Scholz.

"Participants in a demonstration that the AfD and NPD also helped mobilize tried to storm the Reichstag," parliamentarian for Germany's Green party Konstantin von Notz said, referring to two far-right parties in Germany.

"It is just disgusting and shameful," the politician said.
Vulnerable entry point targeted

Video of the event posted online showed a crowd of people standing outside the door of the Reichstag, where only three police officers blocked their entry.

Police were able to drive the crowd back with pepper spray and deescalate the situation. They then cleared the square in front of the Reichstag.

"We can't be everywhere all the time," Thilo Cablitz, a spokesman for the Berlin police, said. "This exact gap was sought out in an attempt to get around the barricade, to break through, and to get onto the steps of the Reichstag."

Authorities arrested around 300 people, according to Berlin state's Interior Minister Andreas Geisel. Around 200 of those were detained in front of the Russian embassy, where a crowd of some 3,000 Reichsbürger supporters and far-right extremists threw stones and bottles at police.

another embedded video

Berlin police break up protest against COVID-19 policy

United against a 'common enemy'

Secretary-General of the SPD Lars Klingbeil said he was surprised that Germany's domestic intelligence service had not received advanced warnings "that right-wing extremists were trying to infiltrate this demonstration."

"We will have to take a closer look at why these warnings were apparently not available in advance or were not properly evaluated," said the SPD politician said on the television show "BILD Live."

The Bundestag's advisory committee will now clarify "what security concepts looked like."

Speaking with DW, author and Internet activist Katharina Nocun said the diversity of the groups that participated in Saturday's demonstration is concerning.

"It is really hard to tell what this demonstration was really about because the organizers don't distance themselves from esoteric groups, from conspiracy theorists, from the far-right," she said. "They say, 'We have one common enemy, which is the government.'"

kp/mm (dpa, Reuters)


Read more:Opinion: A coronavirus fiasco with one ray of hope

Dachsie
18th January 2021, 11:34 AM
Norway rushes to vaccinate and kill its nursing home residents and rushes to lie about the number of deaths and calms the public by telling them there is no causal relationship between the vaccine and the deaths.



https://www.bloomberg.com/news/articles/2021-01-18/norway-finds-no-direct-link-between-elderly-deaths-and-vaccine

https://assets.bwbx.io/images/users/iqjWHBFdfxIU/i9TMlWntuWTs/v1/1000x-1.jpg



Until Friday, Norway had only used the Pfizer-BioNTech vaccine.

Photographer: Jean-Francois Monier/AFP/Getty Images

Health authorities in Norway sought to allay safety concerns raised by the death of some elderly patients after they were vaccinated against Covid-19, saying there’s no evidence of a direct link.

The initial reports from Norway raised alarm as the world looks for early signs of potential side effects from the vaccines. Although doctors say it’s possible that vaccine side-effects could aggravate underlying illnesses, they were expecting nursing-home residents to die shortly after being vaccinated because deaths are more common among the frailest and sickest elderly patients.

“Clearly, Covid-19 is far more dangerous to most patients than vaccination,” Steinar Madsen, medical director at the Norwegian Medicines Agency, said by phone on Monday, adding that a connection between the vaccine and the deaths is difficult to prove. “We are not alarmed.”

What to Know About Vaccine-Related Deaths, Allergies: QuickTake

In Norway, 33 people aged 75 and over died following immunization, according to the agency’s latest figures. All were already seriously ill, it said. The Scandinavian country has already inoculated almost all of its nursing home population, with more than 48,000 people vaccinated as of Monday afternoon.

The reported fatalities are well under 1 out of 1,000 nursing-home patients to be vaccinated, he said. The side effects of immunization can, in some cases, “tip the patients into a more serious course of the underlying disease,” Madsen said. “We can’t rule that out.”
Hong Kong Request

Other countries, including Germany and Israel, have also reported deaths in people who recently were vaccinated, without identifying causal links. Hong Kong’s government-appointed vaccine advisory panel said Monday that it’s seeking more data from the Norwegian and German governments on incidents involving the Pfizer-BioNTech shot, which has been approved in the territory.

Experts on vaccines and aging had predicted early on that deaths after vaccinations in high-risk patients might cause confusion.

“Frail, older adults die, and die often, and I don’t think people realize that,” said Keipp Talbot, an associate professor of medicine at Vanderbilt University who advises the U.S. Centers for Disease Control and Prevention on vaccine use. “My concern was that we would introduce vaccine, and people would think it was killing people.”

Talbot was the only person on the CDC advisory panel to recommend against offering Covid-19 vaccines first to old and sick people in nursing homes -- not because she was concerned they’d be harmed, she said, but because she was concerned that inevitable deaths shortly after shots would lower trust in the vaccines. Talbot said she also thought it might be a better use of scarce supplies to immunize the people surrounding the old and sick.

One key metric would be to compare the number of people who would typically die in a nursing home with the number who die shortly after getting a Covid vaccine, Talbot said.
Daily Deaths

“It is important to remember that about 45 people die every day in nursing homes in Norway, so it is not a given that this represents any excess mortality or that there is a causal connection,” Camilla Stoltenberg, head of the Norwegian Institute of Public Health, said at a press conference on Monday.

Until Friday, Norway had only used the vaccine provided by Pfizer Inc. and BioNTech SE. The companies are now working with the Nordic country to look into the deaths. The first Europe-wide safety report on the Pfizer-BioNTech vaccine is due to be published at the end of January.

What Bloomberg Intelligence Says...

“The concept of limiting Covid-19 vaccinations to those below 75 years of age isn’t supported by the U.S. data covering over 14 million people inoculated, our analysis shows, despite Norway reporting a much higher death rate after using the Pfizer-BioNTech vaccine. Norway’s excessive deaths suggest they are in subjects with serious, uncontrolled illnesses.”

-- Sam Fazeli, Bloomberg Intelligence Senior Industry Analyst

--Click here for the full report

Madsen said he isn’t expecting a different outcome with another vaccine, from Moderna Inc., which was introduced in Norway on Friday. Like the Pfizer-BioNTech shot, it uses messenger RNA technology that teaches the body’s cells to fight off infection.

The Norwegian Medicines Agency says it made clear before the vaccination program started that “it is expected that deaths will occur in a time-related context with vaccination” for the “oldest and sickest” people receiving inoculation.

— With assistance by Stephen Treloar

UP NEXT
Covid-19 Vaccine Deaths, Allergic Reactions: How Many Died in Norway?

https://www.bloomberg.com/news/articles/2021-01-18/norway-finds-no-direct-link-between-elderly-deaths-and-vaccine

Dachsie
18th January 2021, 12:06 PM
FYI
find a way to get ivermectin pills without a prescription, like maybe from Mexico and find out daily dose. This seems like an easy way to protect yourself and with almost no side effects. However, you will be helping satan if you buy anything from Amazon.


Amazon sells ivermectin pills for humans but looks like is prescription only from doctor to buy it.

I just heard guest on ACH show say taking ivermectin as prophylactic will absolutely prevent you from getting this "flu" and that you can take an aspirin a day to keep your blood flowing freely. Problem solved.

https://cldup.com/0LFAarflqG.mp3 about at 37 minutes



https://www.amazon.com/s?k=ivremectin&ref=nb_sb_noss


Showing results for ivermectin
Search instead for ivremectin
Prescription Required
Ivermectin (Generic for Soolantra, Topical Cream)
Ivermectin (Topical Cream, Generic for Soolantra)
Pay with insurance
$-- View copay price in cart
Or pay without insurance. Price is $677.25. Join Prime and save 22%.
Amazon Pharmacy FREE delivery
FSA or HSA eligible
Prescription Required
Ivermectin (Generic for Stromectol, Oral Tablet)
Ivermectin (Oral Tablet, Generic for Stromectol)
Pay with insurance
$-- View copay price in cart
Or pay without insurance. Price is $53.34.
Amazon Pharmacy FREE delivery
FSA or HSA eligible
Prescription Required
Soolantra (Brand for Ivermectin, Topical Cream)
Soolantra (Topical Cream, Brand for Ivermectin)
Pay with insurance
$-- View copay price in cart
Or pay without insurance. Price is $482.40. Join Prime and save 28%.
Amazon Pharmacy FREE delivery
FSA or HSA eligible
Prescription Required
Stromectol (Brand for Ivermectin, Oral Tablet)
Stromectol (Oral Tablet, Brand for Ivermectin)
Pay with insurance
$-- View copay price in cart
Or pay without insurance. Price is $128.40. Join Prime and save 26%.
Amazon Pharmacy FREE delivery
FSA or HSA eligible
Durvet Ivermectin Paste Equine Dewormer - 3 Pack
Durvet Ivermectin Paste Equine Dewormer - 3 Pack
4.7 out of 5 stars 1,374
$19.53-
$138.95
FREE Shipping on eligible orders

can buy over the counter ivermectin as a paste or an injection for farm animals as a dewormer without a prescription.

Dachsie
18th January 2021, 12:29 PM
https://static-3.bitchute.com/live/cover_images/Rbtrop3rRlZl/9g3wHSik4g4r_640x360.jpg

https://www.bitchute.com/video/9g3wHSik4g4r/

56:08 video runtime

Dr. Simone Gold - The truth about the CV19 vaccine

AWESOME presentation by the brilliant Dr. Simone Gold of "America's Frontline Doctors" who was fired from her job as a result of standing up for the truth of the CV19 "pandemic" and the injections that they're trying to sell as "vaccines."

Sign the petition by "Stop Medical Discrimination" here:
https://stopmedicaldiscrimination.org/

https://www.americasfrontlinedoctors.com/

So far still up at: https://www.youtube.com/watch?v=xFntHpk1uok&feature=youtu.be (56:08)

Dachsie
18th January 2021, 02:40 PM
https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-january-18-2021


JANUARY 18, 2021 CORONAVIRIS REPORT FROM TruNews.com

14:08 video runtime

SnifferJoe surfaces to contribute his usual embarrassment at 01:41.

TruNews Headlines with Kerry Kinsey - January 18, 2021

55 people in the US have died after getting the COVID-19 vaccine, that according to reports submitted to a federal database, the Vaccine Adverse Event Reporting System, Del Bigtree says,‘We are rolling out an untested vaccine; I believe there is going to be mass carnage,’ California officials call for a pause on specific Moderna vaccines due to allergic reactions, a priest prepares his congregation for the upcoming Biden years; ‘We are in for it, folks’ 33 people have died in Norway from taking the vaccine, and on "Corona Crazy’ see how Italians start singing “freedom” and refuse police orders to leave a restaurant, and a timely prayer request for a man’s grandparents who are considering getting the vaccine.

Dachsie
19th January 2021, 02:50 PM
https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-january-19-2021

TruNews Corona Report for Tuesday, January 19, 2021

15:07 video runtime

includes clip from new movie PLANET LOCKDOWN

Dachsie
20th January 2021, 02:11 AM
https://twitter.com/vegsource/status/1350949847629770753



Jeff Nelson
@vegsource

Covid is a true killer. So far it’s killed the flu, cancer, heart disease - it killed the ability to think, logic & common sense. It killed the economy, the working class, & millions of jobs. It killed millions of businesses, human connection, love and compassion.
5:35 PM • Jan 17, 2021•Twitter for iPhone

42.8K
Retweets

2.5K
Quote Tweets

113K
Likes

Dachsie
20th January 2021, 03:07 PM
https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-january-20-2021

TruNews Corona Report for January 20, 2021

13:31 video runtime

05:25 to 12:05 Corona Report

Another clip from movie, Planet Lockdown.

PlanetLockdownfilm.com


https://www.planetlockdownfilm.com/

PLANET LOCKDOWN

HAVING THE COURAGE TO FACE OUR FEARS

A DOCUMENTARY AND INTERVIEW SERIES ON OUR CURRENT SITUATION.

FULL INTERVIEWS TELL THE COMPLETE STORY

FULL LENGTH DOCUMENTARY COMING MID FEBRUARY

DONATE HERE

SIGN UP FOR UPDATES ON THE PROJECT HERE

embedded video

Dachsie
21st January 2021, 08:53 AM
https://in-this-together.com/covid-19-evidence-of-global-fraud/


COVID 19 – Evidence Of Global Fraud
TOPICS:covid 19crimefraudpandemicsars-cov-2


https://itt002-itt.netdna-ssl.com/wp-content/uploads/2020/11/Cover001.jpeg?x56485

Posted By: Iain November 16, 2020

COVID 19, and the subsequent governmental responses, appear to be part of an international conspiracy to commit fraud. It seems there is no evidence that a virus called SARS-CoV-2 causes a disease called COVID 19.

Sometimes you have to go with your gut. I am not an expert in genetics and, as ever, stand to be corrected. However my attention was drawn to some research published by the Spanish medical journal D-Salud-Discovery. Their advisory board of eminently qualified physicians and scientists lends further credibility to their research. Their claim is astounding.

The genetic primers and probes used in RT-PCR tests to identify SARS-CoV-2 do not target anything specific. I followed the search techniques outlined in this English translation of their report and can corroborate the accuracy of their claims about the nucleotide sequences listed in the World Health Organisations protocols. You can do the same.

D-Salud-Discovery state there are no tests capable of identifying SARS-CoV-2. Consequently all claims about the alleged impact of COVID 19 on population health are groundless.

The entire official COVID 19 narrative is a deception. Ostensibly, there is no scientific foundation for any part of it.

If these claims are accurate we can state that there is no evidence of a pandemic, merely the illusion of one. We have suffered incalculable loss for no evident reason, other than the ambitions of unscrupulous despots who wish to transform the global economy and our society to suit their purposes.

In doing so this “parasite class” have potentially committed countless crimes. These crimes can and should be investigated and prosecuted in a court of law.


Identification of What Exactly?

The World Health Organisation (WHO) classified COVID-19 (COronaVIrus Disease 2019). They declared a global COVID 19 pandemic on March 11th 2020.

The WHO’s Laboratory testing guidance states:

“The etiologic agent [causation for the disease] responsible for the cluster of pneumonia cases in Wuhan has been identified as a novel betacoronavirus, (in the same family as SARS-CoV and MERS-CoV) via next generation sequencing (NGS) from cultured virus or directly from samples received from several pneumonia patients.”

The WHO’s claim is that the SARS-CoV-2 virus causes the disease COVID-19. They also allege this virus has been clearly identified by researchers in Wuhan.

In the WHO’s Novel Coronavirus 2019-nCov Situation Report 1, they state:

“The Chinese authorities identified a new type of coronavirus, which was isolated on 7 January 2020……On 12 January 2020, China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”

These two statements from the WHO clearly suggest the SARS-CoV-2 virus was isolated (meaning purified for study) and then genetic sequences were identified from the isolated sample. From this, diagnostic kits were developed and distributed globally to test for the virus in towns, cities and communities around the world. According to the WHO and Chinese researchers, these tests will find the virus that causes COVID 19.

Yet the WHO also state:

“Working directly from sequence information, the team developed a series of genetic amplification (PCR) assays used by laboratories.”

The Wuhan scientists developed their genetic amplification assays from “sequence information” because there was no isolated, purified sample of the so called SARS-CoV-2 virus. They also showed electron microscope images of the newly discovered virions (the spiky protein ball containing the viral RNA.)

However, such protein structures are not unique. They look just like other round vesicles, such as endocytic vesicles and exosomes.

Virologists claim that it is not possible to “isolate” a virus because they only replicate inside host cells. They add that Koch’s postulates do not apply because they relate to bacteria (which are living organisms). Instead, virologists observe the virus’ cytopathogenic effects (CPE), causing cell mutation and degradation, in cell cultures.

When Chinese researchers first sequenced the full SARS-CoV-2 genome they observed CPE in Vero E6 and Huh7 cells. Vero E6 are an immortalised monkey cell line and Huh7 are immortalised cancer (tumorigenic) cells. Meaning they have been maintained in vitro (in petri dish cultures) for many years.

Central to the official SARS-CoV-2 story is the idea that it is a zoonotic virus, capable of bridging the species gap from animals to humans. When scientists from the U.S. CDC “infected” various cells with the novel virus they noted the following:

“We examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549) [lung celles], human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81 [monkey cells]……No cytopathic effect was observed in any of the cell lines except in Vero cells [monkey cells]…….HUH7.0 and 293T cells showed only modest viral replication and A549 cells [human lung tissue cells] were incompatible with SARS-CoV-2 infection.”

The CDC did not observe any CPE in human cells. They saw no evidence that this alleged virus caused any human illness. Nor did this supposed human virus show any notable replication in human cells, suggesting human to human infection would be impossible.

It is not clear that SARS-CoV-2 is a human virus capable of causing widespread illness. It may not even physically exist. Is it nothing more than a concept based upon predictive genetic sequences?

Voyage Of Discovery

The Wuhan Center for Disease Control and Prevention and the Shanghai Public Health Clinical Centre published the first full SARS-CoV-2 genome (MN908947.1 ). This has been updated many times. However, MN908947.1 was the first genetic sequence describing the alleged COVID 19 etiologic agent (SARS-CoV-2).

All subsequent claims, tests, treatments, statistics, vaccine development and resultant policies are based upon this sequence. If the tests for this novel virus don’t identify anything capable of causing illness in human beings, the whole COVID 19 narrative is nothing but a charade.

The WUHAN researchers stated that they had effectively pieced the SARS-CoV-2 genetic sequence together by matching fragments found in samples with other, previously discovered, genetic sequences. From the gathered material they found an 87.1% match with SARS coronavirus (SARS-Cov). They used de novo assembly and targeted PCR and found 29,891-base-pair which shared a 79.6% sequence match to SARS-CoV.

They had to use de novo assembly because they had no priori knowledge of the correct sequence or order of those fragments. Quite simply, the WHO’s statement that Chinese researchers isolated the virus on the 7th January is false.

The Wuhan team used 40 rounds of RT-qPCR amplification to match fragments of cDNA (complimentary DNA constructed from sampled RNA fragments) with the published SARS coronavirus genome (SARS-CoV). Unfortunately it isn’t clear how accurate the original SARS-CoV genome is either.

In 2003 a team of researchers from from Hong Kong studied 50 patients with severe acute respiratory syndrome (SARS). They took samples from 2 of these patients and developed a culture in fetal monkey liver cells.

They created 30 clones of the genetic material they found. Unable to find evidence of any other known virus, in just one of these cloned samples they found genetic sequences of “unkown origin.”

E Gene target sequence

Examining these unknown RNA sequences they found 57% match to bovine coronavirus and murine hepatitis virus and deduced it was of the family Coronaviridae. Considering these sequences to suggest a newly discovered SARS-CoV virus (new discoveries being ambrosia for scientists), they designed RT-PCR primers to test for this novel virus. The researchers stated:

“Primers for detecting the new virus were designed for RT-PCR detection of this human pneumonia-associated coronavirus genome in clinical samples. Of the 44 nasopharyngeal samples available from the 50 SARS patients, 22 had evidence of human pneumonia-associated coronavirus RNA.”

Half of the tested patients, who all had the same symptoms, tested positive for this new alleged virus. No one knows why the other half tested negative for this novel SARS-CoV virus. The question wasn’t asked.

This supposed virus had just a 57% sequence match to allegedly known coronavirus. The other 43% was just “there.” Sequenced data was produced and recorded as a new genome as GenBank Accession No. AY274119.

The Wuhan researchers subsequently found an 79.6% sequence match to AY274119 and therefore called it a novel strain of SARS-CoV (2019-nCoV – eventually renamed SARS-CoV-2). No one, at any stage of this process, had produced any isolated, purified sample of any virus. All they had were percentage sequence matches to other percentage sequence matches.


Isolate Nothing

Scientists are very annoyed because they keep saying the virus has been isolated but no one believes them. This is because, as yet, no one has provided a single purified sample of the SARS-CoV-2 virus. What we have instead is a completed genome and, as we are about to discover, it isn’t particularly convincing.

Investigative journalists Torsten Engelbrecht and Konstantin Demeter asked some of the scientists who said they had images of SARS-C0V-2 virions to confirm these were images of an isolated, purified, virus. None of them could.

In Australia scientists from the Doherty Institute, announced that they had isolated the SARS-CoV-2 virus. When asked to clarify the scientists said:

“We have short (RNA) sequences from the diagnostic test that can be used in the diagnostic tests”

This explains why the Australian government state:

“The reliability of COVID-19 tests is uncertain due to the limited evidence base…There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”

In The UK, in July, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in which they asked him to:

“Produce independently peer reviewed scientific evidence proving that the Covid-19 virus has been isolated.”

To date they have not received a reply.

Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England (PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus. To which they responded:

“PHE can confirm it does not hold information in the way suggested by your request.”

Canadian researcher Christine Massey made a similar freedom of information request, asking the Canadian government the same. To which the Canadian government replied:

“Having completed a thorough search, we regret to inform you that we were unable to locate any records responsive to your request.”

In the U.S. the Centre For Disease Control (CDC) RT-PCR Diagnostic Panel state:

“…No quantified virus isolates of the 2019-nCoV are currently available……..Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.”

Last updated on 13th July 2020, the CDC are yet to obtain any pure viral sample from any patient said to have the disease of COVID-19. They openly admit their tests don’t necessarily show if SARS-CoV-2 is either present or causes COVID 19.

We are told that none of this matters. That we are ignorant and just don’t understand virology. Therefore, we must except pictures of things we know could be something else and genetic sequences (which could be anything else) as conclusive proof that this virus, and the disease it is supposed to cause, are real.


Testing For Nothing

The WHO, and every government, think tank, policy steering committee, government scientific advisor, supranational institutions and others who promote the official COVID 19 narrative, assert that SARS-CoV-2 causes COVID 19. While no one has ever produced a sample of this supposed virus, the alleged SARS-CoV-2 genome has been published. It is in the public domain.

Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to identify the presence of the “virus”. These include:

RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of COVID 19 diseased epithelial cells.
S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.
E gene (Orf1ab) – small membrane protein used in viral assembly
N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation

The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)

The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers.

It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in a sample.

Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore we can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences.

The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.

The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.

However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.

Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.

Whenever we check the so called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.

So called fact checkers, like Reuters’ Health Feedback project, have been quick to dismiss the claims of those who have noticed the apparent lack of specificity in the supposed SARS-CoV-2 genome. Using a slew of strawman arguments like, “this claim suggests every test should be positive,” (which it doesn’t) their debunking attempt runs something like this:

Primers are designed to bind to specific nucleotide sequences that are unique to the virus. The forward primer may bind to a particular chromosome but the reverse primer doesn’t bind to the same chromosome and so the chromosome is not present in the SARS-CoV-2 virus. Moreover because the forward and reverse primers envelop the sequence to be amplified the cDMA sequence between primers is unique to the virus.

This seems to deliberately misrepresent the significance of these findings by forwarding an argument that no one, other than the fact checkers themselves, are making. BLAST searches show that these target sequences are not unique to SARS-CoV-2. Nor do all targets need to be found for a result to be deemed positive.

Moroccan researchers investigated the epidemiology of Moroccan alleged cases of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As we have just discussed, many may have been positive for none.

This is entirely in keeping with WHO’s test guidelines. They state:

“An optimal diagnosis consists of a NAAT [nucleic acid amplification test] with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used……One or more negative results do not necessarily rule out the SARS-CoV-2 infection.”

Regardless of the spurious arguments of well funded fact checkers, if the forward and reverse primers identify junk, perhaps one being the fragment of a chromosome and the other a microbial sequence, then the amplified region between them is probably junk too.

The argument that RT-PCR only finds RNA is specious. Natural transcription (the separation of DNA strands) occurs during gene expression. No one is saying whole chromosomes or microbes are sequenced in the alleged SARS-CoV-2 genome. Though they may, for all we know. They are saying the alleged markers, used to test for this supposed virus, are not fit for purpose.

RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called “junk,” DNA (cDNA.)

For example the SARS-CoV-2 S gene is meant to be highly specific to the SARS-CoV-2 virus genome. The target sequence is – TTGGCAAAATTCAAGACTCACTTTC. A microbial BLAST search returns 97 microbial matches with 100% identity sequence match. The lowest identity percentage match, within the top 100, is 95%. A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments.

No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO’s test protocols that clearly identifies what it is. The whole genome could be false. The tests do not prove the existence of SARS-CoV-2. All they reveal is a soup of unspecified genetic material.

If so, as there are no isolates or purified samples of the virus, without a viable test, there is no evidence that SARS-CoV-2 exists. Therefore, nor is there any evidence that a disease called COVID 19 exists.

This infers that there is no scientific basis for any claims about COVID 19 case numbers, hospital admissions or mortality figures. All measures taken to combat this deadly virus are quite possibly founded upon nothing.


Conclusive Fraud

Fraud is a criminal act. The legal definition of fraud is:

“Some deceitful practice or willful device, resorted to with intent to deprive another of his right, or in some manner to do him an injury.”

The Legal definition of a conspiracy is:

“A combination or confederacy between two or more persons formed for the purpose of committing, by their joint efforts, some unlawful or criminal act”

It seems, those who claim we face a pandemic have not provided any evidence to show that a virus called SARS-CoV-2 causes a disease called COVID 19. All of the information strongly suggesting this possibility is readily available in the public domain. Anyone can read it.

For there to be a fraud the deceit must be wilful. The intention must be to deliberately deprive others of their rights or injure them in some other way. If there is evidence of collusion between individuals ad/or organisations to commit fraud, then this is a conspiracy (in Common Law jurisdictions) or a Joint Criminal Enterprise (JCE) under International Law.

It seems COVID 19 has been deliberately used as a casus belli to wage war on humanity. We have been imprisoned in our own homes, our freedom to roam restricted, freedom of speech and expression eroded, rights to protest curtailed, separated from loved ones, our businesses destroyed, psychologically bombarded, muzzled and terrorised .

Prince Charles telling us to embrace the Great Reset

Worse still, while there is no evidence of unprecedented all cause mortality, there were unseasonable spikes in deaths. These correlate precisely with Lockdown measures which saw the withdrawal of the health services we pay for and a reorientation of public health services to treat one alleged disease at the exclusion of all others.

Further, it is proposed by those who have forwarded the COVID 19 story, that this alleged disease provides justification for the complete restructuring of the global economy, our political systems, societies, cultures and humanity itself.

To be allowed to participate in their so called “new normal,” which is the wholesale transformation of our entire society without our consent, they insist we submit to their conditions.

These include, but aren’t limited to, bio-metric surveillance of everyone, the centralised control and monitoring of all of our transactions, oppressive business and social restrictions and an effective demand that we have no right to sovereignty over our own bodies. This constitutes the condition of slavery.

There is no doubt that we have been deprived of our rights and injured. In Common Law jurisdictions innocence is presumed, but the evidence that harm has been deliberately caused by an international conspiracy is overwhelming. Destructive policies, enacted by governments across the world, clearly originated among globalist think tanks and supranational institutions long before the emergence of this non existent pandemic.

In Napoleonic Code jurisdictions, guilt is presumed. In order for the accused conspirators to prove their innocent they must show that, despite their immeasurable resources, they have collectively been unable to access or understand any of the freely available evidence suggesting COVID 19 is a myth.

Those responsible for the crime of conspiracy to commit global fraud should be tried. If found guilty they should be imprisoned while the rest of us get on with trying to repair the damage they have already inflicted.

Dachsie
21st January 2021, 10:36 AM
https://www.bitchute.com/static/v129/images/play-button.png



Need to Know: The Fetzer Report Episode 112 - 19 January 2021
Watch

https://www.bitchute.com/video/mKgzXIikWGeJ/

1:01:58 video runtime

virus / vaccine part of this video

begins at 28:04

and ends at 40:47

Dachsie
21st January 2021, 10:34 PM
https://www.youtube.com/watch?v=cbveErE7pjM

Tucker Carlson Tonight 1/21/21 FULL | FOX BREAKING NEWS January 21 ,21
14,749 views


Tucker said.. in first minute of this scathing negative criticism of Biden's first day in office.

"CNN can go ahead and take that Covid death ticker off the screen. There's no need for it now. It's not like you can blame Joe Biden for some virus that escaped from a Chinese lab in Wuhan. That wouldn't be fair. Come on now. CNN dutifully removed it this morning.

Covid deaths ? ! Settle down, America, it's just a bad flu season.

Joe Biden apparently agrees. Joe Biden and his family appeared last night without their masks. Biden explained "we're celebrating a historic day in our country. We have bigger things to worry about."
•Premiered 3 hours ago
809
75
Share
Save
Taylor Gacha
Tucker Carlson Tonight 1/21/21
Like and subscribe channel
Thank all For watching…

_______________

Very odd things going on with Fox News for January 21, including Tucker Carlson show, Lou Dobbs show and Hannity show.

All extremely negative against Biden.

Something big is cooking and many games behind the scenes.

_______________________


https://www.youtube.com/watch?v=O_HL16sxpfw

Lou Dobbs Tonight 1/21/21 FULL | Fox BREAKING TRUMP NEWS January 21, 21
86,873 views
•Jan 21, 2021
2.1K206Share
Save
Taylor Gacha
Lou Dobbs 1/21/21 Get a breakdown of the day’s top stories and how they iact the economy! Like and subscribe channel Thank all For watching….



_____________


https://www.youtube.com/watch?v=UMLnHlBe-ic

___________________


https://www.youtube.com/watch?v=_xnlpOPhyJ

Tucker Carlson Tonight 1/21/21 | FOX BREAKING NEWS January 21 ,21
29,365 views
•Premiered 2 hours ago
3.7K473ShareSave
Taylor Gacha
Tucker Carlson Tonight 1/21/21 Like and subscribe channel Thank all For watching…
Thisa one was erased by YouTube but dublicate is above.

Taylor Gotch channel uperimposes on his thumnails photos of his videos of Joe and Nancy in orange prison uniforms.

Dachsie
22nd January 2021, 08:15 AM
Now that the communists have successfully installed the commander-and-thief, the MSM coronavirus and vaccine propaganda will starkly change. No more concern for rule of law and justice in doing their crimes against humanity as those things no longer exist.

The absurd level of lies and propaganda from the media promoting the "virus" and the "vaccine" is no longer necessary.

It is understood that our unitary totalitarian NewState operates, by default, in lying, cheating and stealing.

"The coronavirus pandemic will “fade away” even without a vaccine"

President Donald Trump

woodman
22nd January 2021, 08:29 AM
"The coronavirus pandemic will “fade away” even without a vaccine"

President Donald Trump

Trump said this?

Dachsie
22nd January 2021, 12:06 PM
https://www.mostholyfamilymonastery.com/images/someone-in-bidens-earpiece-says-salute-the-marines-so-he-says-salute-the-marines.jpg

Biden breaks his own "law" shortly after mandating that all must wear face masks when on federal property

https://www.mostholyfamilymonastery.com/images/biden-breaks-his-own-law-shortly-after-mandating-that-all-must-wear-face-masks-when-on-federal-property.jpg

https://twitter.com/charliekirk11/status/1352110403266912259?ref_src=twsrc%5Etfw%7Ctwcamp%5 Etweetembed%7Ctwterm%5E1352110403266912259%7Ctwgr% 5E%7Ctwcon%5Es1_&ref_url=https%3A%2F%2Fwww.mostholyfamilymonastery. com%2Fnews%2Fbiden-breaks-his-own-law-shortly-after-mandating-that-all-must-wear-face-masks-when-on-federal-property%2F

Charlie Kirk
@charliekirk11
·
Jan 20
Does Joe Biden’s new executive order mandating masks on federal property not apply to Joe Biden while he’s on federal property?

Because here he is at the Lincoln Memorial with no mask just hours after signing it.

Charlie Kirk
@charliekirk11
·
Jan 20
Does Joe Biden’s new executive order mandating masks on federal property not apply to Joe Biden while he’s on federal property?

Because here he is at the Lincoln Memorial with no mask just hours after signing it.

embedded video on twitter

Dachsie
22nd January 2021, 12:55 PM
https://www.bitchute.com/video/hAEq4ekmxcCT/


I DO NOT COMPLY!




Watch

https://static-3.bitchute.com/live/cover_images/Rbtrop3rRlZl/hAEq4ekmxcCT_640x360.jpg


Jan 22, 2021
I DO NOT COMPLY!

Trailer for the I DO NOT COMPLY Campaign - a grassroots, global movement. It is a campaign dedicated to sharing the stories of people all around the world who will no longer accept the tyrannical Covid-19 regulations and mandates that seek to remake our societies and strip us of our freedoms. It is also a pledge and an oath of resistance. We hereby declare that WE ARE DONE BEING COMPLIANT. We are done being silent.

https://www.youtube.com/watch?v=V_cTeZZjk3U&feature=emb_logo (3:38)


3:38 video runtime

Dachsie
22nd January 2021, 04:20 PM
https://www.wsls.com/news/2021/01/22/baseball-legend-former-home-run-king-henry-hank-aaron-dies-at-86/

Baseball legend, former home run king Henry ‘Hank’ Aaron dies at 86
Aaron hit 755 career home runs, holding the record for 33 years

Baseball Hall of Famer Hank Aaron has died.

WSB-TV in Atlanta reports that the one-time home run king died on Friday morning, according to his daughter.

Aaron, who was inducted into the hall of fame in 1982, played 23 MLB seasons, from 1954 to 1976.

In that time, he hit 755 home runs, a record he held for 33 years until it was broken by Barry Bonds.

The 25-time All-Star was also a three-time Gold Glove winner and won one World Series in 1957 with the Milwaukee Braves.

A cause of death has not yet been release for Aaron.


https://pbs.twimg.com/card_img/1351644415102746628/O5bwCUIS?format=jpg&name=small

Hank Aaron
@HenryLouisAaron
·
Jan 5
I was proud to get the COVID-19 vaccine earlier today at Morehouse School of Medicine. I hope you do the same!
A few weeks ago, he did receive the COVID-19 vaccine (on January 6, 2021) .

https://encrypted-tbn3.gstatic.com/shopping?q=tbn:ANd9GcT7AzfEdyHz-wNWE16ZpfnC2yn_wjtLkn8QDD98ruvSp-p7i73dE0CIA4RkbFR3nr6b3Cq-n3Y&usqp=CAc

Dachsie
22nd January 2021, 04:56 PM
https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-january-22-2021

04:40 to 09:40 Corona Report part of this 13:51 video runtime

Inspiring message from Dale Bigtree

An embarrassing misspeak from Chucky "Israel First" Schumer

Mariocopa county store owner confronts mask wearer on his store's "mask free Friday" rule. Needs to pull gun on contrarian customer.

Good show

PatColo
22nd January 2021, 06:03 PM
WHO Releases New COVID Test Guidelines To Greatly Reduce Case Numbers And Make It Appear Vaccines Are Working
(https://christiansfortruth.com/who-releases-new-covid-test-guidelines-to-greatly-reduce-case-numbers-and-make-it-appear-vaccines-are-working/)
JANUARY 22, 2021 By CFT TEAM (https://christiansfortruth.com/author/cft/) 3 COMMENTS (https://christiansfortruth.com/who-releases-new-covid-test-guidelines-to-greatly-reduce-case-numbers-and-make-it-appear-vaccines-are-working/#comments)


https://christiansfortruth.com/wp-content/uploads/2021/01/covid-test.jpg (https://christiansfortruth.com/wp-content/uploads/2021/01/covid-test.jpg)


In what some have suggested is politicized timing, the World Health Organization on Wednesday changed the protocol for COVID-19 tests (https://www.lifesitenews.com/news/one-hour-after-biden-inaugurated-who-changes-covid-testing-criteria?utm_source=top_news&utm_campaign=standard), which will result in large reductions in the numbers of positive cases — which will then be held up as “proof” that the highly publicized vaccines have helped end the “pandemic”:



The body took this action just one hour after Joe Biden was sworn in as president of the United States.

On Wednesday, the World Health Organization (WHO) issued guidance regarding the polymerase chain reaction (PCR) test, which is being widely used across the globe in order to detect cases of COVID-19. In a short information notice, the WHO referred back to an instruction booklet for COVID testing, released in September 2020, noting that “careful interpretation of weak positive results is needed.”

The guidance warned against diagnosing someone as having the virus just because he tests positive if he does not present with symptoms of COVID-19.

It also warned about the high risk of false positives: “The cycle threshold (Ct) needed to detect virus is inversely proportional to the patient’s viral load. Where test results do not correspond with the clinical presentation, a new specimen should be taken and retested using the same or different NAT technology.”

“As disease prevalence decreases, the risk of false positive increases. The probability that a person who has a positive result (SARS-CoV-2 detected) is truly infected with SARS-CoV-2 decreases as prevalence decreases, irrespective of the claimed specificity,” the WHO continued.

An even more surprising admission followed: the document described PCR tests merely as an “aid for diagnosis” and did not place any greater weight upon the results of PCR tests. “Most PCR assays are indicated as an aid for diagnosis, therefore, health care providers must consider any result in combination with timing of sampling, specimen type, assay specifics, clinical observations, patient history, confirmed status of any contacts, and epidemiological information.”

The new guidance for assessing the results of PCR COVID tests effectively means that there are additional steps to be taken before reporting that someone has tested positive for the virus. The WHO notes that “a new specimen should be taken and retested” and further stipulates that “health care” workers should weigh up the test result alongside real-world information, such as symptoms or “clinical observations,” and contact with any other infected individuals.



We’ve been predicting for the last 8 months that this is exactly what they would do in order to “end the pandemic” — change the cycling threshold (https://christiansfortruth.com/anthony-fauci-admits-chances-of-getting-accurate-results-from-covid-pcr-tests-are-miniscule/) for the PCR test, which would automatically eliminate all the false positives.

And that’s why they chose the PCR “test” (https://christiansfortruth.com/who-finally-admits-covid-pcr-tests-unreliable-but-promoted-them-anyway-to-justify-vaccines/) from the very beginning — because it is not really a diagnostic “test” at all, but a laboratory method for studying small fragments of DNA.

Now that it’s done what it was supposed to do — create the illusion of a pandemic — the PCR can be demoted from the “gold standard (https://christiansfortruth.com/how-the-gold-standard-pcr-test-for-covid-19-has-been-misused-to-create-a-fake-pandemic/)” of COVID tests to a mere “diagnostic aid” that should be confirmed when the patient presents actual physical symptoms.

By making these new recommendations, the WHO is essentially signaling that the first phase of “pandemic” is over — and we will now see more and more stories of infection rates slowly declining, as Israel has begun doing (https://www.jpost.com/health-science/coronavirus-number-of-new-cases-continues-to-slowly-decline-656353) — as more and more people are vaccinated with the worthless and dangerous “vaccines” (https://christiansfortruth.com/covid-mrna-vaccines-are-legally-not-vaccines-and-you-cannot-be-legally-forced-to-take-any-of-them/).

But remember — Anthony Fauci himself proclaimed (https://bgr.com/2020/10/27/coronavirus-vaccine-efficacy-explained-fauci-interview/) that these COVID vaccines won’t stop you from “contracting” the virus — it will only help lessen the severity of the “disease” if you become symptomatic.

In that sense, we should see no decline in “infection” rates — or case numbers — in the wake of the vaccine roll out.

But we will see a decline in case numbers because of these new WHO’s recommendations for changes in the PCR test standards — which will be used to “prove” the vaccines now magically do “block” new infections.

But we will all still have to wear useless masks (https://christiansfortruth.com/flashback-2003-public-warned-surgical-masks-do-not-protect-against-sars-covid-virus/) and social distance because — well — just because.


https://christiansfortruth.com/who-releases-new-covid-test-guidelines-to-greatly-reduce-case-numbers-and-make-it-appear-vaccines-are-working/
(https://christiansfortruth.com/who-releases-new-covid-test-guidelines-to-greatly-reduce-case-numbers-and-make-it-appear-vaccines-are-working/)

Dachsie
22nd January 2021, 07:49 PM
https://www.who.int/news/item/20-01-2021-who-information-notice-for-ivd-users-2020-05

WHO Information Notice for IVD Users 2020/05

Home/
News/
WHO Information Notice for IVD Users 2020/05

WHO Information Notice for IVD Users 2020/05
Nucleic acid testing (NAT) technologies that use polymerase chain reaction (PCR) for detection of SARS-CoV-2
20 January 2021 Medical product alert
Geneva
Reading time: 1 min (370 words)
AddThis Sharing Buttons
Share to Print
Share to Email
Share to Facebook
Share to Twitter
Share to More
العربية
中文
Français
Русский
Español
Português

Product type: Nucleic acid testing (NAT) technologies that use polymerase chain reaction (PCR) for detection of SARS-CoV-2

Date: 13 January 2021

WHO-identifier: 2020/5, version 2

Target audience: laboratory professionals and users of IVDs.

Purpose of this notice: clarify information previously provided by WHO. This notice supersedes WHO Information Notice for In Vitro Diagnostic Medical Device (IVD) Users 2020/05 version 1, issued 14 December 2020.

Description of the problem: WHO requests users to follow the instructions for use (IFU) when interpreting results for specimens tested using PCR methodology.

Users of IVDs must read and follow the IFU carefully to determine if manual adjustment of the PCR positivity threshold is recommended by the manufacturer.

WHO guidance Diagnostic testing for SARS-CoV-2 states that careful interpretation of weak positive results is needed (1). The cycle threshold (Ct) needed to detect virus is inversely proportional to the patient’s viral load. Where test results do not correspond with the clinical presentation, a new specimen should be taken and retested using the same or different NAT technology.

WHO reminds IVD users that disease prevalence alters the predictive value of test results; as disease prevalence decreases, the risk of false positive increases (2). This means that the probability that a person who has a positive result (SARS-CoV-2 detected) is truly infected with SARS-CoV-2 decreases as prevalence decreases, irrespective of the claimed specificity.

Most PCR assays are indicated as an aid for diagnosis, therefore, health care providers must consider any result in combination with timing of sampling, specimen type, assay specifics, clinical observations, patient history, confirmed status of any contacts, and epidemiological information.

Actions to be taken by IVD users:

Please read carefully the IFU in its entirety.
Contact your local representative if there is any aspect of the IFU that is unclear to you.
Check the IFU for each incoming consignment to detect any changes to the IFU.
Provide the Ct value in the report to the requesting health care provider.

Contact person for further information:

Anita SANDS, Regulation and Prequalification, World Health Organization, e-mail: rapidalert@who.int

References:

1. Diagnostic testing for SARS-CoV-2. Geneva: World Health Organization; 2020, WHO reference number WHO/2019-nCoV/laboratory/2020.6.

2. Altman DG, Bland JM. Diagnostic tests 2: Predictive values. BMJ. 1994 Jul 9;309(6947):102. doi: 10.1136/bmj.309.6947.102.

____________________________

https://principia-scientific.com/who-finally-admits-covid19-pcr-test-has-a-problem/

WHO Finally Admits COVID19 PCR Test Has a ‘Problem’

Published on December 17, 2020

Written by John O'Sullivan



https://i2.wp.com/principia-scientific.com/wp-content/uploads/2020/12/1-2.jpg?resize=550%2C370&ssl=1

In a statement released on December 14, 2020 the World Health Organization finally owned up to what 100,000’s of doctors and medical professionals have been saying for months: the PCR test used to diagnose COVID-19 is a hit and miss process with way too many false positives.

This WHO-admitted “Problem” comes in the wake of international lawsuits exposing the incompetence and malfeasance of public health officials and policymakers for reliance on a diagnostic test not fit for purpose.

This World Health Organization admission is that the crux of the “problem” is a wholly arbitrary cycling process which “means that many cycles were required to detect virus. In some circumstances, the distinction between background noise and actual presence of the target virus is difficult to ascertain.” [emphasis added]

The UN body is now clearly looking to distance itself from the fatally flawed test as a growing number of lawsuits are processing through the courts exposing the insanity of relying on a test that even the inventor, Professor Kary B. Mullis said was never designed to diagnose diseases. [1]

https://i1.wp.com/principia-scientific.com/wp-content/uploads/2020/12/m-3.jpg?w=536&ssl=1

Professor Mullis was awarded the Nobel Prize in Chemistry in 1993. ‘Coincidentally’, Mullis died just before the pandemic started.

We reported on November 22, 2020 that a landmark court case in Portugal had ruled that the polymerase chain reaction test (PCR) used worldwide to diagnose COVID-19 was not fit for purpose. Most importantly, the judges ruled that a single positive PCR test cannot be used as an effective diagnosis of infection.

As Off-Guardian.org reported at the time:

“In their ruling, judges Margarida Ramos de Almeida and Ana Paramés referred to several scientific studies. Most notably this study by Jaafar et al., which found that – when running PCR tests with 35 cycles or more – the accuracy dropped to 3%, meaning up to 97% of positive results could be false positives.

The ruling goes on to conclude that, based on the science they read, any PCR test using over 25 cycles is totally unreliable. Governments and private labs have been very tight-lipped about the exact number of cycles they run when PCR testing, but it is known to sometimes be as high as 45. Even fearmonger-in-chief Anthony Fauci has publicly stated anything over 35 is totally unusable.”

You can read the complete ruling in the original Portuguese here, and translated into English here.

Among thousands of angry doctors arguing PCR tests should not be used is Dr. Pascal Sacré. He wrote that:

“This misuse of RT-PCR technique is used as a relentless and intentional strategy by some governments, supported by scientific safety councils and by the dominant media, to justify excessive measures such as the violation of a large number of constitutional rights, the destruction of the economy with the bankruptcy of entire active sectors of society, the degradation of living conditions for a large number of ordinary citizens, under the pretext of a pandemic based on a number of positive RT-PCR tests, and not on a real number of patients.”

Clear and conclusive scientific evidence proves that these tests are not accurate and create a statistically significant percentage of false positives. Positive results more likely indicate “ordinary respiratory diseases like the common cold.” [2]

https://i2.wp.com/principia-scientific.com/wp-content/uploads/2020/12/mmm-1.jpg?resize=550%2C498&ssl=1

However, none of this is new information to science. These facts were known at least before 2007 after a New York Times report entitled, “Faith in Quick Test Leads to Epidemic That Wasn’t,” (image, above) clearly showed how scientifically inaccurate PCR tests are, featuring many shocking statements from medical experts on the use of these tests, clearly laying out how they result in false positives and lead to dangerous exaggerations and false alarms. [3]

In their 2007 story the New York Times cited a prescient quote from Dr. Elizabeth Talbot, deputy state epidemiologist for the New Hampshire Department of Health and Human Services, who said:

“One of the most troubling aspects of the pseudo-epidemic is that all the decisions seemed so sensible at the time.”

Those who run our public institutions have allowed history to repeat itself. At the head of the line of incompetence and malfeasance is the UN itself. At the media briefing on COVID-19 on March 16, 2020, the WHO Director General Dr Tedros Adhanom Ghebreyesus (photo, below) said:

“We have a simple message for all countries: test, test, test.”

https://i0.wp.com/principia-scientific.com/wp-content/uploads/2020/12/nnn-4.jpg?w=491&ssl=1

This insanity of testing anyone and everyone, even without symptoms has been an unmitigated global public health scandal and must be stopped. All officials in high places complicit in this crime must be prosecuted.

About the author: John O’Sullivan John is CEO and co-founder (with Dr Tim Ball) of Principia Scientific International (PSI). John is a seasoned science writer and legal analyst who assisted Dr Ball in defeating world leading climate expert, Michael ‘hockey stick’ Mann in the ‘science trial of the century‘. O’Sullivan is credited as the visionary who formed the original ‘Slayers’ group of scientists in 2010 who then collaborated in creating the world’s first full-volume debunk of the greenhouse gas theory plus their new follow-up book.

[1] Kary Mullis : « Le test PCR ne permet pas de savoir si vous êtes malade », vidéo accessible sur YouTube, 9 octobre 2020.

[2] David DeGraw, Torsten Engelbrecht and Konstantin Demeter, https://www.globalresearch.ca/national-security-alert-covid-tests-scientifically-fraudulent-epidemic-false-positives/5720271

[3] New York Times,’Faith in Quick Test Leads to Epidemic That Wasn’t,’ Gina Kolota, Published: January 22, 2007

PatColo
23rd January 2021, 07:12 AM
This India woman "Ramola D" has a moderate sized YT (16K subs) & bitchute (368 subs) ch's, & some good interviews & roundtables. The hotter ones are found at her BC ch (https://www.bitchute.com/channel/1LxN7TgTbJV7/), recent titles include:





https://static-3.bitchute.com/live/cover_images/1LxN7TgTbJV7/OnQ3gOfibSfz_640x360.jpghttps://www.bitchute.com/static/v129/images/play-button.png
1961:28:39
(https://www.bitchute.com/video/OnQ3gOfibSfz/)
Jan 21, 2021
Celeste Solum Interviews Ramola D: Neuro & Surveillance Tech (https://www.bitchute.com/video/OnQ3gOfibSfz/)
Wide-ranging interview with focus on Neurotech/EMF targeting of activists and non-activists by criminals running fusion center operations, and black ops divisions in Military/Intel.






https://static-3.bitchute.com/live/cover_images/1LxN7TgTbJV7/wtH6ufJ4dbt7_640x360.jpghttps://www.bitchute.com/static/v129/images/play-button.png
4701:37:41
(https://www.bitchute.com/video/wtH6ufJ4dbt7/)


Jan 19, 2021
News Panel 15 | Report 228 | The Current Situation: Dangers of Deception, Fraud & Cover Ops (https://www.bitchute.com/video/wtH6ufJ4dbt7/)
Thought-provoking conversation on the dangers of the current situation rife with deception on the numbers of cases from high false-positives on the PCR test, unpacking of the vaccine as a genetic engineering bioweapon, dangerous side effects being reported, and information from Pfizer and the MHRA on what really is in the vaccine--synthetic RNA and lipid nanoparticles, among other ingredients. Unexpected dive into the subject of controlled opposition among 5G activists and TI activists, replete with smear operations and harassive bully attacks, the misrepresentation of activists as insane by front-people and governments who use mental health fraud to stop whistleblowing and exposure of govt crime and corruption, and the need for tenacity and truth in all exposure and activism.






https://static-3.bitchute.com/live/cover_images/1LxN7TgTbJV7/MgwxE3gKCQxy_640x360.jpghttps://www.bitchute.com/static/v129/images/play-button.png
1721:51:39
(https://www.bitchute.com/video/MgwxE3gKCQxy/)


Jan 16, 2021
Interviews with Changemakers (18): Peggy Hall, The Healthy American on Masks, Laws, Language, Rights (https://www.bitchute.com/video/MgwxE3gKCQxy/)
Impassioned and educative conversation with Peggy Hall, educator, writer, activist, who has founded a new organization The Healthy American to help Americans and people worldwide recognize their rights to health freedom and health choice in an age of government overreach and COVID overkill.
Peggy shares what prompted her to rush into the fray of this national and global conversation as she herself experienced being laid-off from her teaching job in a university, and turned her attention within two weeks of the interminable lockdown in March to the language of the law, the nature of the “Orders” being issued by Health Officers and Governors, and the fraudulent impositions of stricture and “requirement” devoid of statutory legal backing which Governors and Mayors are using to subjugate the American populace. In actuality, the “Orders” are mere Guidance or Guidelines; neither Governors nor Mayors have the jurisdictional authority to impose orders of any kind on individuals






https://static-3.bitchute.com/live/cover_images/1LxN7TgTbJV7/gyfBXSMLMmN0_640x360.jpghttps://www.bitchute.com/static/v129/images/play-button.png
29381:02:43
(https://www.bitchute.com/video/gyfBXSMLMmN0/)


Jan 16, 2021
Newsbreak 105 | Frances Leader on UK MHRA Info:COVID Vaccine Uses Computer-Generated Codes, No Virus (https://www.bitchute.com/video/gyfBXSMLMmN0/)
Explosive information from Frances Leader, avid researcher, investigator, and writer, who questioned the UK MHRA and confirmed from them that the RNA genome sequences for the supposed SARS-COV-2 virus being used in the COVID vaccines comes from a string of computer-generated codes, not a real virus. There is no fact no real virus: no virus has been isolated, grown in a petri dish, reinfected anyone, or been spread to anyone--Koch's postulates for defining existence of a virus. What the PCR test is finding is genetic material related to Human Chromosome 8 and found to be common to all living beings; in other words, not a deadly SARS virus but aspects of the living genome shared by all organisms, possibly, Or exosomes from the actions of cells reacting to stresses caused possibly by electromagnetic radiation, specifically 5G--which is still being rolled out worldwide. The importance of knowing there is no specific organic virus that has been isolated and that is being used in the vaccine cannot be underestimated. What it implies is that synthetically-manufactured proteins using gene sequencing technology are being injected into human cells, with the intention of altering the human genome and having no connection whatsoever with a putative virus they are supposed to be protecting from. It also means nobody needs this vaccine--why does anyone need to be injected with computer-generated protein codes formulated synthetically in a lab? Please share this information widely, and look for added commentary on this finding from medical journalists and doctors, moving forward.






https://static-3.bitchute.com/live/cover_images/1LxN7TgTbJV7/gqoFJyr4BsNm_640x360.jpghttps://www.bitchute.com/static/v129/images/play-button.png
1822:29
(https://www.bitchute.com/video/gqoFJyr4BsNm/)


Jan 16, 2021
Video Snippet--Global Gestapo 12 (https://www.bitchute.com/video/gqoFJyr4BsNm/)
Video Snippet 1 -- on infiltration and backdoors into society at "authority" levels by secret societies and fraternities.






https://static-3.bitchute.com/live/cover_images/1LxN7TgTbJV7/ldT7VtYDRIeXyJh9JFmx00vm_640x360.jpghttps://www.bitchute.com/static/v129/images/play-button.png
8771:08:54
(https://www.bitchute.com/video/D6xGKU8Utg9F/)


Jan 16, 2021
Report #227 | Dr. Carrie Madej: Reprogramming of Cells Without Informed Consent--Moratorium Needed (https://www.bitchute.com/video/D6xGKU8Utg9F/)
Blockbuster conversation with Dr. Carrie Madej exposing the fact that the Pfizer and Moderna COVID-vaccine is experimental in nature, has not been properly tested in humans, has not been proven safe and effective- (she explains closely how the raw data has been manipulated), and raises many questions regarding dangerous side-effects and adverse events, including death, as well as pointing to the genetic reprogramming of human cells without informed consent provided to those who take it: this is a transhumanizing and nanobot-containing vaccine, but people do not seem to understand this; given the multiple numbers of adverse effects being reported, she calls for an immediate moratorium to halt the rollout and calls for medical professionals to speak out.
An article is forthcoming at The Everyday Concerned Citizen. Please share this video widely for immediate dissemination. Look on Bitchute and Brighteon also shortly for uploads.






https://static-3.bitchute.com/live/cover_images/1LxN7TgTbJV7/SCKXf7v2DlvZ_640x360.jpghttps://www.bitchute.com/static/v129/images/play-button.png
21933:35
(https://www.bitchute.com/video/SCKXf7v2DlvZ/)


Jan 08, 2021
NewsBreak 103 | Jan 6, 2021| Note to All Speaking Out Re. Remote-Access Radio Frequency Weaponry (https://www.bitchute.com/video/SCKXf7v2DlvZ/)
Note to all Doctors, Whistleblowers, Researchers, Activists Speaking Out Today for Medical Freedom, Vaccine Choice, Truth & Human Rights to Be Aware Targeted Remote-Access Radio Frequency Weaponry is in Public Use-- covertly, that is, yet documented; and learn how you can shield from it. This is a report from the front lines from a journalist and writer who has been wrongfully targeted and has experienced heart-hits, head-hits, microwave

Dachsie
23rd January 2021, 07:28 AM
"
https://principia-scientific.com/who...has-a-problem/

WHO Finally Admits COVID19 PCR Test Has a ‘Problem’

Published on December 17, 2020"

Just wanted to remind everyone that Trump got the USA out of participation with the WHO in May of 2020.

https://www.cnn.com/2020/05/29/politics/donald-trump-world-health-organization/index.html

He said China controls the WHO and was donating small dollars versus mega US dollars donated to WHO. This is one of the many good actions Trump accomplished, the foremost of which, for me anyway, is having kept the USA out of another war for the globalist banksters.

(The nature of CCP's connection to this "worldwide pandemic" is not appropriate to discuss in this thread. I may start a thread in the Religion / Philosophy section of this forum because that topic is fraught with deliberate voids in our fund of knowledge.)

PatColo
23rd January 2021, 08:29 AM
HARRY VOX interviews Klaus Schwab (spoof, 11m :D)

THE GREAT RESET EXPLAINED (https://www.bitchute.com/video/1Dwv8Fnrxx2N/)

NSFW - potty mouth :o

Shami-Amourae
23rd January 2021, 09:06 AM
January 6:

Hank Aaron, 86, receives COVID-19 vaccine and hopes to inspire other Black Americans to do the same
https://www.cbssports.com/mlb/news/hank-aaron-86-receives-covid-19-vaccine-and-hopes-to-inspire-other-black-americans-to-do-the-same/






January 22:

Hank Aaron, baseball legend, remembered after death
https://www.cbsnews.com/video/hank-aaron-baseball-legend-remembered-after-death/


GET YOUR VACCINES GUYS!

Dachsie
23rd January 2021, 09:08 AM
Tucker Carlson is particularly dyspepsic in his prissy smirky fake commentary. The presentation is full of fake mixed messages. First they tell you how well Florida has handled the virus issue and how many New Yorkers are moving to Florida. Then they tell you one of the ways Florida governor is professionally handling the virus distribution problems is to put all 4.3 million age 65 and over people at the front of the line to receive the vaccine. How murderous, genocidal and evil!!!!

Fox News loves to focus on petty play-acting fake fights between sleazy politicians and presstitutee reporters fake disputes. Fox News is nothing more than a low-grade soap opera production.

Truth about the vaccine and handling the fake pandemic fake virus problem is missing in action.
https://www.youtube.com/watch?v=h5JYIXowrEc


https://www.youtube.com/watch?v=h5JYIXowrEc

8:36 video runtime

(I had to stop at about 3:46 as my nausea tolerance level collpased.)

Ron DeSantis responds to viral clip of him being 'attacked' by CNN reporter
2,173,844 views
•Premiered Jan 5, 2021
44K
1.7K
Share
Save
Fox News
6.79M subscribers
Angry CNN activist takes on Florida Gov. Ron DeSantis on vaccine rollout. Fox Tampa Bar Reporter Craig Patrick and Gov. Ron DeSantis join 'Tucker Carlson Tonight' to discus bias media coverage. #FoxNews #Tucker

PatColo
23rd January 2021, 10:29 AM
January 6:

Hank Aaron, 86, receives COVID-19 vaccine and hopes to inspire other Black Americans to do the same
https://www.cbssports.com/mlb/news/hank-aaron-86-receives-covid-19-vaccine-and-hopes-to-inspire-other-black-americans-to-do-the-same/

January 22:

Hank Aaron, baseball legend, remembered after death
https://www.cbsnews.com/video/hank-aaron-baseball-legend-remembered-after-death/


GET YOUR VACCINES GUYS!


(((Larry King))) also croaked yesterday or this morning sometime - not sure what his "VAXXED!" story was, but he was 87yo, & I *thought* a news story was floated in the recent couple months re his getting the MuhRONA on him.

So many fake stories re celeb-types getting the RONA, as pure propaganda to keep the hoax in the (tabloid...) headlines in addition to the MSM fake news, it's impossible to decipher what's true & fake anymore. :(??

monty
23rd January 2021, 01:40 PM
So many fake stories re celeb-types getting the RONA, as pure propaganda to keep the hoax in the (tabloid...) headlines in addition to the MSM fake news, it's impossible to decipher what's true & fake anymore. http://gold-silver.us/forum/images/smilies/300%20(24).gif

Absolutely. We’re overwhelmed with bs

PatColo
23rd January 2021, 03:05 PM
Russ Winter was Operation Scorpio's 2nd hour guest, & Maryam Henein 3rd hour today. I prefer the audio only version, it's shorter with the commercial breaks cut out:

Operation Scorpio 2021.01.23 (https://grizzom.blogspot.com/2021/01/operation-scorpio-20210123.html)


David Scorpio brings on Hour 2 Russ Winter (https://www.winterwatch.net/) & Hour 3 Maryam Henein (https://www.activistpost.com/2021/01/the-storming-of-the-capitol-inciting-insurrection-or-false-flag-attack-part-1.html). Cohosts Giuseppe Vafanculo & Brutal Honesty Chris Weinert join the party as a new keg of hopium is tapped.Topics include:
1) Generalisimo Biden - Democracy Has Triumphed

2) A Basket Of Cookies

3) Democratic Tyranny
4) The Naked Lunch & Naked Power Grab

audio only, 2h 43m: 64k CF Download (https://ln2.sync.com/dl/2607246b0/m49cx5nb-ntzqcqu2-4qt9ae46-uyai9ssa)

YT: 3h 26m
https://www.youtube.com/watch?v=P9Kpl9J-zB0&feature=emb_title

https://www.youtube.com/watch?v=P9Kpl9J-zB0&feature=emb_title


Tim Kelly / Joe Atwill @
https://tkelly6785757.podomatic.com/

PatColo
23rd January 2021, 03:08 PM
latest Russ Winter Jan 22

Biden’s First 100 Days: What We Can Expect from the New Bolshevik-Stasi Regime (https://www.winterwatch.net/2021/01/bidens-first-100-days-what-we-can-expect-from-the-new-bolshevik-stasi-regime/)

January 22, 2021 (https://www.winterwatch.net/2021/01/) Russ Winter (https://www.winterwatch.net/author/russ-winter/) Articles by Russ Winter (https://www.winterwatch.net/category/articlesbyrusswinter/), Business (https://www.winterwatch.net/category/business/), Crime (https://www.winterwatch.net/category/crime/), Culture (https://www.winterwatch.net/category/culture/), Media (https://www.winterwatch.net/category/media/), Politics (https://www.winterwatch.net/category/politics/), US News (https://www.winterwatch.net/category/usnews/), Winter Watch Articles (https://www.winterwatch.net/category/winterwatcharticles/) 35 (https://www.winterwatch.net/2021/01/bidens-first-100-days-what-we-can-expect-from-the-new-bolshevik-stasi-regime/#mh-comments)
https://www.winterwatch.net/wp-content/uploads/2021/01/Back-to-the-Bolsheviks.jpg

A news commentator on Thursday said it will probably take three months to digest all of the messaging within cutout President Joseph R. Biden’s inaugural address. Indeed. We saw it as an exercise in gaslighting.

What’s clear is that Biden, Democrat-controlled Capitol Hill and their mainstream media sycophants are working overtime to portray their political opposition (aka “Trump supporters”) as dangerous white supremacists who are betraying their country’s ideals. Former CIA, FBI and military mucky mucks are comparing populists/nationalists/traditionalists (PNT) to al Qaeda and Islamic State terrorists. Tucker Carlson sums up the threat in this clip of his Jan. 19 broadcast.

moar https://www.winterwatch.net/2021/01/bidens-first-100-days-what-we-can-expect-from-the-new-bolshevik-stasi-regime/

Dachsie
24th January 2021, 05:28 AM
https://answersingenesis.org/blogs/ken-ham/2021/01/20/inauguration-day-whats-next-for-christians/?utm_source=articlesmedia&utm_medium=email&utm_term=20210123&utm_content=1-banner-cta&mc_cid=941b388ac8&mc_eid=17c1d03f93

52:41 video runtime

The Foundations and Flaws of Viral Theory - Dr. Tom Cowan


The Foundations and Flaws of Viral Theory - Dr. Tom Cowan (https://www.bitchute.com/video/JnBTkHnNzv1G/)

https://static-3.bitchute.com/live/cover_images/Rbtrop3rRlZl/JnBTkHnNzv1G_640x360.jpg

First published at 22:53 UTC on January 23rd, 2021.

channel image

Jim Fetzer

Jim Fetzer

3497 subscribers

Tom Cowan demolishes current virology theory, showing it to be an emperor with no clothes. With characteristic logic, humor and subtle sarcasm he explains in common terms how we're all being sold a ridiculous paradigm in the name of "science." HIGHLY recommended!!!

Dachsie
24th January 2021, 06:41 AM
Dr. Tom Cowan mentioned in his recent video posted in this thread that he is about to publish a study done with Dr. Stephan Lanka.

Here is information about Dr. Lanka.

https://purebibleforum.com/index.php?threads/stefan-lanka-dismantles-modern-virus-theory.1520/

https://purebibleforum.com/index.php?attachments/stefan-lanka-jpg.532/

Here are five good documents by Dr Stefan Lanka to read if you want to understand the problems and fraud within "virology" and why people like myself do not believe in the existence of "viruses".

“The Virus Misconception Part 1 – Measles as an example” – by Dr Stefan Lanka
https://truthseeker.se/the-virus-mi...j6hgHYSbgBLMtV0C3FlnTiFeMRoqu6F_-C_pZVBaTdRew
PDF (same doc)
https://truthseeker.se/wp-content/u...-Measles-as-an-example-By-Dr-Stefan-Lanka.pdf

“The Virus Misconception Part 2 – The beginning and end of the corona crisis” – by Dr Stefan Lanka
https://truthseeker.se/the-virus-mi...5KKz95jsV1eurxN2Dl_S20WEdDGDKzSLGMJZmMICbP3IU
PDF (same doc)
https://truthseeker.se/wp-content/uploads/The-Virus-Misconception-Part-2-The-beginning-and-end-of-the-corona-crisis-By-Dr-Stefan-Lanka.pdf

"The Misinterpretation of the Antibodies" with Dr Stefan Lanka
https://truthseeker.se/stefan-lanka...xdzcP579mrDrY192tlFEZFTvAyfOX7zfWffxbvQZVk 9VI
PDF - (same doc) Translated and edited by Northern Tracey and John Blaid
From German article https://telegra.ph/Die-Fehldeutung-der-Antikörper-07-12
https://truthseeker.se/wp-content/uploads/Stefan-Lanka-The-Misinterpretation-of-the-Antibodies-English-Translation.pdf

Dr Stefan Lanka Interview July 2020 - "Virologist", molecular and marine biologist. All claims of "virus" existence refuted.
https://truthseeker.se/lanka_interv...GRMcCLu9Aax3EcOQny2OKbbypihtOGrAjLd SNtfqK5IH4
PDF (same doc)
https://truthseeker.se/wp-content/uploads/Lanka_interview_July-2020-English-Translation.pdf
How Dead Are Viruses Anyway?
Dr Stefan Lanka, molecular and marine biologist
All claims of Virus Existence Refuted
[Unofficial English translation of Die Wurzel’s interview with Stefan Lanka in July 2020
https://www.die-wurzel.de reproduced with permission
https://t.me/Corona_Fakten/209 ]

"No Panic - Dr Stefan Lanka on Bird Flu, AIDS and the Corruption of Medicine"
https://truthseeker.se/no-panic-dr-...ZihvoP9dXq2pdGo5Jci6ty7XfElul3cY_yb4vKZ20bniM
PDF (same doc) - Feb 24, 2006
https://truthseeker.se/wp-content/uploads/No-Panic-Dr-Stefan-Lanka-on-Bird-Flu-AIDS-and-the-Corruption-of-Medicine.pdf

===========================

Dachsie
24th January 2021, 08:34 AM
https://img.ifunny.co/images/0e9a83904c5bcd8f3d32f27e8268b5dde867e1102aeeff9861 ca31ca11a51bb3_1.jpg

PatColo
24th January 2021, 01:23 PM
2 latest from Max @ his BC ch,



https://static-3.bitchute.com/live/cover_images/tj99AwcN3zlH/cEKG1OsKWd9O_640x360.jpghttps://www.bitchute.com/static/v129/images/play-button.png
38:59
(https://www.bitchute.com/video/cEKG1OsKWd9O/)

Jan 22, 2021
The Q-denburg Disaster (https://www.bitchute.com/video/cEKG1OsKWd9O/)




https://static-3.bitchute.com/live/cover_images/tj99AwcN3zlH/l1rQis0cj1g9_640x360.jpghttps://www.bitchute.com/static/v129/images/play-button.png
37:14
(https://www.bitchute.com/video/l1rQis0cj1g9/)

Jan 21, 2021
Pedodent Joe Biden and the Fall of the Republic (https://www.bitchute.com/video/l1rQis0cj1g9/)



& latest from Vernon Jordan Coleman this past week

The PCR Test is Useless for Covid-19 (But Useful for Crooked Governments)
(https://brandnewtube.com/watch/the-pcr-test-is-useless-for-covid-19-but-useful-for-crooked-governments_H39cdYx6Iml3viB.html)Dr Vernon Coleman (https://brandnewtube.com/@DrVernonColeman)
7,520 Views · 1 day ago


Following the Science? Don't Make Me Laugh. (https://brandnewtube.com/watch/following-the-science-don-039-t-make-me-laugh_qiYQoAugnaFOrGl.html)
Dr Vernon Coleman (https://brandnewtube.com/@DrVernonColeman)
13,861 Views · 5 days ago

Dachsie
24th January 2021, 02:45 PM
"& latest from Vernon Jordan this past week"

Suggest Coleman instead of Jordon.

PatColo
24th January 2021, 02:54 PM
^ ahahhahaha yes of course :D

Dachsie
24th January 2021, 05:31 PM
https://www.bitchute.com/video/NEhI4OgpRXLn/

Timmy Learns About COVID Vaccines (https://www.bitchute.com/video/NEhI4OgpRXLn/)

2 minute video runtime

https://static-3.bitchute.com/live/cover_images/5W8Qpgv76n77/NEhI4OgpRXLn_640x360.jpg

Timmy Learns About COVID Vaccines

This is a public service announcement. You are being manipulated to give up your freedom in order to be "free" again. They plan to keep the world locked down until everyone receives a vaccine passport. How insane is it, that everyone must give up their freedom and liberty in order to be free again? It's enslavement! It's extortion! It's blackmail! It's COMMUNISM!!!

Johnny Supertramp is now ONLY on Bitchute - Sub, Share & Support @

Dachsie
24th January 2021, 05:46 PM
https://www.bitchute.com/video/UasEs3yWHoyM/

Joe Biden’s first days as President
(https://www.bitchute.com/video/UasEs3yWHoyM/)
06:42 video runtime

Pay close attention starting at about 04:20 on this video track.

Biden just rejoined the World Health Organization when Trump thankfully got the USA out of that part of the global cesspool last year. China owns and operates the WHO and guess who owns and operates China.

Anyway the WHO did put out its "updated revised" PCR testing guidelines, which I posted a few posts back in this thread.

1. high amplification rates make the PCR test basically meaningless. If the testing laboratory uses a high amplification rate, the likelihood of producing a "false positive" is greatly increased. I do not know if the brand of test includes / dictates amplification rate or if the doctor can specify amplification rate to the lab order of the test on the patient. Seems the amp rate is set and goes with the policy of the laboratory since these days they are giving these tests in makeshift mass test specimen acquisition sites on the patient with no doctor's order at any level.

(Truth is, the PCR test is and always was meaningless for the purpose of diagnosing ANY condition. (The PCR testing technology is properly used as a tool of "bench scientists", I think in gene studies.)

2. the WHO now says that diagnosis of covid 19 of a patient should only be made in combination with

a second confirmatory test

AND

clinical presentation of symptoms,

The Who was pressured into making these policy concessions -- see "finally admits" Principia article I posted a bit earlier.

However, we all know by this time that it is ALL GIGO, all Garbage In, Garbage Out, all LIES upon LIES, upon LIES.

The new medical SCIENCE is totalitarian - one dictated "fact", one dictated policy, and that is

the END OF SCIENCE.

https://static-3.bitchute.com/live/cover_images/5W8Qpgv76n77/UasEs3yWHoyM_640x360.jpg

04:12 starts "covid" part

First published at 13:30 UTC on January 24th, 2021.

#joe-biden

channel image

debess

debess

13458 subscribers

Joe Biden wasted no time -- he snubbed minorities by firing US Surgeon General, Dr. Jerome Adams, a black man. Signed a mask mandate for federal employees on federal property which he immediately violated. Banished US troops to a parking garage. Broke promises like not banning fracking and not wanting to make Covid vaccinations mandatory. He then appointed Tom Vilsack (Mr. Monsanto) as his agriculture secretary. The one positive thing from all this is that lies are being revealed and lies create truth seekers.

https://www.who.int/news/item/20-01-2021-who-information-notice-for-ivd-users-2020-05

PatColo
25th January 2021, 04:24 AM
Not sure which platform Dr Carrie posted this at, or who/what created the "checklist" - found it @ Dr Tenpenny's new Gab acct:
https://gab.com/BusyDrT/posts/105613140424477243

nice to see gab allows "hotlinking" of the images they host, unlike twatter!

https://media.gab.com/system/media_attachments/files/063/107/030/original/f0bf85bb2a3370e9.jpeg

Dachsie
25th January 2021, 02:18 PM
https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-january-25-2021

13"12 total runtime of video

Today's Corona Report from Kerry Kinsey of TruNews. Advise to listen to whole broadcast since at the beginning they have started a new regular feature of this daily weekdays shows titled "Commie Crackdown."

corona reporting begins at 03:17 with concerning news from Dr. Andrew Wakefield.

News about China origin of the "virus" money trail leading straight to Tony the Rat."

12:23 ends covid reporting

TruNews Headlines with Kerry Kinsey - January 25, 2021

Steve Hilton of FOX News finds stunning Covid 19 connections. There’s activity from Dr. Anthony Fauci’s institute, that details specific funding and it is terrifying. Hilton shows a progress report form the Wuhan lab and he claims the money trail leads back to Fauci.

Dr. Andrew Wakefield says the only way we’re going to avoid mandated vaccines, in the U.S., is to have a huge uprising like they did in Denmark. Dr. Wakefield, says; “How do they know a third wave of Covid is coming; that is extremely worrisome."

Today on ‘Corona Crazy,’ did they really find Covid laced ice cream in China? And on "Commie Crackdown,’ Senator Tom Cotton says, “We cannot tolerate China trying to influence government officials at the highest levels of American Government.”
Content Contributed By — TruNews Team

Take the broadcast with you!

PatColo
25th January 2021, 05:35 PM
2m 20s clip inside: https://gab.com/a/posts/105618932603291234



Andrew Torba
(https://gab.com/a)


1h
(https://gab.com/a/posts/105618932603291234)
This mask nonsense is out of hand, is this how we want to live in this country?

Dachsie
26th January 2021, 01:26 PM
https://www.kcra.com/article/california-edd-audit-details-failures-of-ill-prepared-unemployment-agency/35323869

Patient dies in Placer County after receiving COVID-19 vaccine

Multiple agencies investigating cause of death

PLACER COUNTY, Calif. —

A person who received a COVID-19 vaccine died hours after receiving the dose, according to the Placer County Sheriff’s Office.

Deputies say the person tested positive in late December and received the vaccine Thursday.
Advertisement

The county’s public health department did not administer the vaccine.

Officials said several agencies are investigating the cause of death.

"There are multiple local, state, and federal agencies actively investigating this case; any reports surrounding the cause of death are premature, pending the outcome of the investigation," the sheriff's office said.

On Monday, California Secretary of Health Dr. Mark Ghaly said state officials are aware of the case and are working closely with the Placer County coroner's office and county health officer.

"Some details are complex and worth further investigation and that's what we're doing," Ghaly said.

Ghaly said his confidence in the vaccine remains hgih.

"We are very experienced with reactions and even dire consequences related to clinical interventions, including vaccines," he said. "But we are looking at this very closely and still stand behind the data and overwhelming evidence that these vaccines are safe."

The Centers for Disease Control and Prevention is monitoring reports of severe allergic reactions, but health officials say the risk of a severe reaction is “exceedingly rare.”

In a statement sent to KCRA, a spokesperson for the CDC said they are aware of reports that people died after receiving the vaccine, but said they are rare.

"These deaths are under investigation to verify information and determine cause of death. It’s important to remember that many adverse events, including death, following immunization are often coincidental – that means that while an adverse event may happen after getting vaccinated, the vaccine is not always the cause of it," according to the statement.

https://scontent-dfw5-2.xx.fbcdn.net/v/t1.0-0/s552x414/141846400_3598822543505550_3712924586818520517_o.j pg?_nc_cat=104&ccb=2&_nc_sid=110474&_nc_ohc=4KhJQK3WEMwAX_SUWIK&_nc_oc=AQm3Fdwu-xHy4eRq4cxOkAYi7dfw-TwboCuA6XVYNdXRt8QvzGRn5ysKBHqW1-5jb6Je-eLoyj_WGQ-aItQjipX-&_nc_ht=scontent-dfw5-2.xx&tp=7&oh=e3c2445af5bf73037941bebc95ae8b33&oe=60342F95

Placer County Public Health and the Placer County Sheriff-Coroner Division were recently notified of the death of an individual who tested positive for COVID-19 in late December.

The individual was administered a COVID-19 vaccine several hours before their death on January 21, 2021. The vaccine was not administered by Placer County Public Health. There are multiple local, state, and federal agencies actively investigating this case; any reports surrounding the cause of death are premature, pending the outcome of the investigation. Our thoughts are with the family of the decease
3K

Dachsie
26th January 2021, 03:33 PM
https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-january-26-2021

TruNews Corona virus news for Tuesday Jan. 26.

@10"18 the CDC is getting reports of deaths after #covid vaccinations at 120 x (yes 120 times) the rate for flu vaccines "

Tweet somewhere here...

https://twitter.com/alexberenson

03:50 to 11:52 Corona Report part of 13:03 full video runtime

Tony the Rat makes $418.6 K yearly salary

PatColo
26th January 2021, 05:21 PM
new Dr Carrie pub'd today, 75m:

Atlantic Underground Podcast Episode #34 (Guest Dr. Carrie Madej - Part 2) (https://www.youtube.com/watch?v=Pz28NWQEukU)


https://www.youtube.com/watch?v=Pz28NWQEukU


^ she also twatted out this story today... https://twitter.com/DrMadej/status/1354179106859057153

we know da dinjoo-nuffins are behind the MuhRONA scam, coz they show their "happy merchant rubbing hands" when they can't resist promoting this form of 'testing'...

COVID Anal Swabs for Beijing Residents More Accurate, Says Chinese Expert (https://www.newsweek.com/covid-anal-swabs-beijing-residents-more-accurate-says-chinese-expert-1564381)

BY JOHN FENG (https://www.newsweek.com/authors/john-feng)ON 1/26/21

Dachsie
26th January 2021, 05:21 PM
PLEASE Explain To Me False Positive VS. False Negative (https://www.bitchute.com/video/hfNe7BcEP8pB/)
https://www.bitchute.com/static/v129/images/play-button.png

https://static-3.bitchute.com/live/cover_images/WUr1Bgs0dihq/SUaKktCRGCHblIHiAkYRPoXi_640x360.jpg


https://www.bitchute.com/video/hfNe7BcEP8pB/

06:33 video runtime

First published at 23:23 UTC on January 26th, 2021.

channel image

Think About It

Think About It

10295 subscribers

There seems to be such a disparity in the available information these days. A large portion of the population in America today says they don't even trust their media to tell them the facts...

Dachsie
27th January 2021, 01:36 PM
https://static-3.bitchute.com/live/cover_images/Rbtrop3rRlZl/aNcWzJFzDoW4_640x360.jpg

https://www.bitchute.com/video/aNcWzJFzDoW4/

1:15:42 video runtime



First published at 13:14 UTC on January 27th, 2021.

channel image

Jim Fetzer

Jim Fetzer

3628 subscribers

REQUIRED VIEWING/LISTENING! Extremely good and simple explanations for why our current paradigm of viral infection is completely wrong! Tom Cowan is the BEST of the many brilliant doctors who are trying to bring people out of the GRAND DECEPTION that’s been imposed upon the world in the form of a fautly/fraudulent concept of “viral infection” and a phony “viral pandemic” built on the “sand” of that wrong concept.

“There are a thousand hacking at the branches of evil to one who is striking at the root.” – Henry David Thoreau

Dachsie
27th January 2021, 03:01 PM
https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-january-27-2021

TruNews Headlines with Kerry Kinsey - January 27, 2021

On ‘Corona Crazy,’ Dr. Anthony Fauci says you should wear two masks now and we’ll show how some are taking this too far.

Ron Paul says Fauci’s policy on face coverings is schizophrenic. Steve Hilton claims Fauci is linked to the origins of the coronavirus. Dr. Vernon Coleman says, ‘the PCR test is useless for Covid but is useful for crooked governments.’’

Dan Bongino says, “liberals are melting down over Trump’s first political move” and Sen. Rand Paul says if Biden really wanted unity he would have said ‘let’s just move on’ past impeachment.
Content Contributed By — TruNews Team



_______________



Steve Hilton of Fox News says he has linked the origins of the coronavirus to Tony the Rat Fauci.

https://www.washingtonpost.com/opinions/a-flu-virus-risk-worth-taking/2011/12/30/gIQAM9sNRP_story.html

2011 article co-authored by Tony the Rat

(Subscirbers only at Wapo can access this article.)

This subject io important and explains "gain of function" and the risk it poses to humanity.

"The work in question was a type of gain-of-function research that involved taking wild viruses and passing them through live animals until they mutate into a form that could pose a pandemic threat. Scientists used it to take a virus that was poorly transmitted among humans and make it into one that was highly transmissible—a hallmark of a pandemic virus. This work was done by infecting a series of ferrets, allowing the virus to mutate until a ferret that hadn’t been deliberately infected contracted the disease.

The work entailed risks that worried even seasoned researchers. More than 200 scientists called for the work to be halted. The problem, they said, is that it increased the likelihood that a pandemic would occur through a laboratory accident."


https://jamesfetzer.org/2021/01/dr-fauci-backed-controversial-wuhan-lab-with-u-s-dollars-for-risky-coronavirus-research/


Dr. Fauci Backed Controversial Wuhan Lab with U.S. Dollars for Risky Coronavirus Research (https://jamesfetzer.org/2021/01/dr-fauci-backed-controversial-wuhan-lab-with-u-s-dollars-for-risky-coronavirus-research/)
January 27, 2021 James Fetzerblog
FRED GUTERL


___________
TruNews Reporter Kerry Kinsey explains GAIN OF FUNCTION this way...

"Researchers were trying to find out if a virus that starts out without the ability to transmit the virus through the air can eventually GAIN the ability..."

_____________

Dachsie Comment:

Since when can a rat do research on a higher animal?

Dachsie
28th January 2021, 09:23 AM
IVERMECTIN

8:28 video runtime

News Roundup | NY Judge Orders Hospital To Use Ivermectin, Woman Recovers

News Roundup | NY Judge Orders Hospital To Use Ivermectin, Woman Recovers (https://www.youtube.com/watch?v=Q6pm5T_E4rw)


219,675 views
•Jan 18, 2021
9K
123
Share
Save
TrialSite News
22.4K subscribers
https://www.youtube.com/watch?v=Q6pm5T_E4rw


New York Supreme Court Judge Order: Give The Patient Ivermectin As Court Battle Leads to Ivermectin for Successful Treatment Against COVID-19:
A judge ordered the Millard Fillmore Suburban Hospital to allow an 80-year old woman to be treated with Ivermectin. According to the family their attorney, the treatment saved the life of Judith Smentkiewicz. Although not yet approved, according to court documents, the woman’s daughter referred to it as a “miracle drug,” as do her attorneys, Ralph C. Lorigo and Jon F. Minear. Apparently, a doctor ordered the drug off-label in the intensive care unit (ICU), and as she improved, she was moved to another unit, and the doctor there stepped in and disallowed the use of the drug. Family members immediately involved lawyers and legal action to resume treatment. And now, The New York Supreme Court Judge Henry J. Nowak has aligned with the family.
https://trialsitenews.com/new-york-su...

Nigeria Government Making Moves to Fund Ivermectin Research Targeting COVID-19: IVERCOVID Program:
The Nigerian federal government commissioned a team of researchers to investigate the efficacy of Ivermectin as a potential treatment for COVID-19. Known as “IVERCOVID,” this group just may impact the world’s approach to treating COVID-19, at least in the developing world.
With ivermectin gaining traction as a potential treatment option, the country’s political leadership becomes ever more intrigued. For example, Vice President Yemi Osinbajo’s declared that Nigeria and Nigerians “are at the cutting edge of scientific research into the COVID-19 treatment.” Fascinated with the fact that the drug is already in use in the country to combat river blindness, the Vice President is considering how to leverage this African nation’s considerable experience and understanding of the drug given growing data pointing toward its potential benefits as a treatment and even prophylactic medication targeting COVID-19.
https://trialsitenews.com/nigeria-gov...

Dachsie
28th January 2021, 12:13 PM
https://www.youtube.com/watch?v=JHGv4CsmVEY


Vaccine Makers Issue Warnings After Reports Of COVID-19 Vaccine Side Effects | CRUX (https://www.youtube.com/watch?v=JHGv4CsmVEY)

2:16 video runtime


707,458 views
•Jan 20, 2021
8.7K
433
Share
Save
CRUX
491K subscribers
India’s union health ministry has issued guidelines on who should avoid taking Covid-19 vaccines. The ministry also warned against interchanging dosages of vaccines. Watch the video to know more.
#covidvaccine #covishield
Crux is your daily dose of the big, viral and relevant news in a few minutes. It’s your ultimate guide to staying informed on the latest in politics, international relations, sports, entertainment and social media

Follow CRUX on Instagram (@crux.india): https://bit.ly/3qSFx1K
Follow CRUX on Facebook: https://bit.ly/2Lte7iF
#GetCloserToTheNews with latest headlines on politics, sports and entertainment on news18.com https://bit.ly/2Y4QccL

Also watch:
Crux One Take: https://bit.ly/3oNaLWf
Crux Files: https://bit.ly/3mnbnjW
Crux BTS: https://bit.ly/3oCjbQE

Dachsie
28th January 2021, 12:49 PM
Doctor Mike Hansen and his youtube channel has been one of the main M.D. propagandists for the fake coronavirus pandemic and now is pushing the dangerous covid 19 vaccines. IN the video below he incredibly advises everyone to get the Pfizer vaccine because the reason Dr. Gregory Michael died is not determined yet. Also incredibly toward the end of the video he states that many patients in intensive care have thrombocytopenia and the patients have recently had the vaccine but he still sees no connection.






https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-january-11-2021

focus on corona at 04:12 to 12:25

https://local12.com/news/nation-world/healthy-south-florida-doctor-died-2-weeks-after-receiving-covid-19-vaccine-cincinnati-gregory-michael-miami-beach-sinai

https://local12.com/resources/media/6e11c61b-3bb5-44b4-93a3-b472d960bb03-medium16x9_5.PNG?1610285284907

Gregory Michael died after taking the COVID-19 vaccine. (Facebook)

"MIAMI BEACH, Fla. (CBS12) — A 56-year-old doctor passed away this week two weeks after getting his first dose of a Pfizer COVID-19 vaccine.

Dr. Gregory Michael, a Miami-Beach obstetrician, was in good health, according to WPDE. Health officials from Florida and the Centers from Disease Control and Prevention are investigating whether the vaccine played a role in his death, which may be the country's first death linked to the vaccine.

Dr. Michael received his first dose of Pfizer's vaccine on Dec. 18 at Mount Sinai Medical Center, the Sun-Sentinel reported. Three days later, small spots began to appear on his feet and hands. He went to the emergency room at Mount Sinai, where he has worked in private practice for 15 years.

Michael's blood count was "far below normal ranges" and he was admitted into the ICU, according to the Sun-Sentinel. Just days before the last resort surgery, he suffered a stroke and died."

Michael's wife said in a Facebook post that he spent the pandemic delivering hundreds of babies and was a COVID-19 vaccine advocate.

_________________

Dachsie comment:

Here is the vidio about Dr. Michael's death where the thrombocytopenia is explained. This vaccine and possibly ALL vaccines cause auto-immune conditions in people because they cause antibodies in the body that cause the body to start attacking the body's own immune system. This happens in different ways for different people. ITP is one of those ways that causes serious life-threatening disease.

https://www.local10.com/news/local/2021/01/07/did-miami-beach-doctor-56-die-from-receiving-covid-19-vaccine/

This doctor died of a condition that Dr. Judy Mikovits mentioned several times in a video very recently posted in this thread --
Thrombocytopenia is a condition characterized by abnormally low levels of platelets, also known as thrombocytes, in the blood. A normal human platelet count ranges from 150,000 to 450,000 platelets per microliter of blood.

Idiopathic thrombocytopenic purpura (ITP) is a rare autoimmune disorder that causes you to have low platelet levels. Platelets are cell fragments that are found in the blood and normally help the blood to clot. In people with ITP, the body produces antibodies that attack and destroy the platelets.





https://www.youtube.com/watch?v=UijQ-6jhVuc

...https://www.youtube.com/watch?v=UijQ-6jhVuc...

08:20 video runtime

Doctor Dies After Getting COVID Vaccine || Florida Doctor's Death
1,059,090 views
•Jan 20, 2021
26K
2.5K
Share
Save
Doctor Mike Hansen
558K subscribers
Doctor Dies After Getting COVID Vaccine || Florida Doctor's Death

An obstetrician/gynecologist (Dr. Gregory Michael) in Miami, Florida, received the 1st dose of the Pfizer vaccine on Dec.18th. Shortly after receiving the Pfizer vaccine, he reportedly developed acute immune thrombocytopenia. He died 16 days after getting the covid vaccine. Dr. Gregory Michael's cause of death is a result of a brain hemorrhage. Obviously, this is horrible. It’s tragic, and you feel for his family.

But it makes you wonder, was his death a result of the covid vaccine?
And if it resulted from the covid vaccine, should that change your perspective on the covid vaccine?
So I’m going to tell you my thoughts on this, but first, let's learn a little more about what happened.
Pfizer is actively investigating the case.

Over 10 million people in the United States have received at least one shot of either the Pfizer Covid Vaccine or Moderna Covid Vaccine, the two authorized in the United States. Me personally, I received both doses of the Pfizer vaccine. So far, there have been about 40 cases of anaphylaxis, meaning a severe allergic reaction. None of which were reported as fatal. Many people have had other side effects like sore arms, fatigue, headache, or fever, which typically last a day or so.

The Miami-Dade County medical examiner’s office is investigating Dr. Gregory Michael's death, and as of right now, there is no official autopsy report. But based on the reports, let's see what we can make of his case.

Dr. Gregory Michael was healthy. He did not smoke. Did not take any medications. Never had any reaction to any medication nor vaccines. Supposedly three days after he gets the 1st dose of covid vaccine, he developed tiny reddish spots, or petechiae, caused by bleeding under the skin of his hands and feet.

This prompted him to go to the ER. He gets blood work done, and his platelet levels are low, which is something called thrombocytopenia. Platelets are one of the components of blood clotting. If platelets are too low, it makes people more prone to bleeding. Normal platelet counts range from anywhere from 150 000 to 400 000 or so. People can have spontaneous bleeding, including internal bleeding, but that doesn't typically happen unless the platelet levels are less than ten thousand. His levels were reportedly zero, and because they're so low or absent, he gets admitted to the intensive care unit for two weeks. Doctors tried to get his platelet count higher as he had experts from all over the country involved in his care. Presumably, they tried several different treatments. Typically we give platelet transfusions, which is really a blood product that we're transfusing. But also, we give steroids, specifically glucocorticoids, such as salmeterol or methylprednisolone. If that doesn't work, we try other drugs like Ramaplastum or eltrombopag to stimulate the bone marrow to make more platelets. Sometimes we give immunoglobulins, sometimes we give a drug called rituximab, which is a monoclonal antibody. If all else fails, the last resort is to take out the spleen because sometimes a spleen plays a role in sequestering and destroying platelets. So they were actually planning on doing a splenectomy, meaning removing his spleen. Still, shortly before that, he ends up developing a hemorrhagic stroke that took his life in a matter of minutes. In other words, he bled into his brain.

A sudden get severe thrombocytopenia to the point of bleeding to death because no matter what the cause is, this kind of thing is incredibly rare. I've never had a similar case like this in the intensive care unit. Now there are some cases like this reported with certain drugs medications can lead to thrombocytopenia. As a result of drug-induced antibodies being made by the immune system, they attack the body's platelets. Drug-induced thrombocytopenia refers to acute immune-mediated thrombocytopenia, and it should be suspected when someone has sudden severe thrombocytopenia.

*** Please watch the full video to get the proper details.

Doctor Mike Hansen, MD
Internal Medicine | Pulmonary Disease | Critical Care Medicine
Website: https://doctormikehansen.com/
IG Account: http://instagram.com/doctor.hansen/
FB Page: https://www.facebook.com/DoctorMikeHa...

#covid #covidvaccine #vaccine

Dachsie
28th January 2021, 03:34 PM
https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-january-28-2021

TruNews Headlines with Kerry Kinsey - January 28, 2021

A CNA nurse whistleblower says seniors at his nursing home are dropping like flies after getting Covid vaccine injections. The man says not a single person passed away in all of 2020 at his facility, but 14 patients have already died in January at his nursing home.

A headline on Ron Paul’s Institute for Peace and Prosperity says, ‘a New York nursing home had zero coronavirus deaths, then, it vaccinates residents for Coronavirus, and the deaths begin.’

Dr.Vernon Coleman says old people are the forgotten generation, ignored, mistreated, and maybe even murdered.

13:29 total video runtime corona news ends at 11:30

Focus is on nursing home truth in this epesode.
China is using anal Covid swabs, and on ‘Corona Crazy,’ a parent goes off on school board members who won’t reopen over Covid concerns, and why are so many troops still in Washington, D.C.?
Content Contributed By — TruNews Team

monty
28th January 2021, 04:29 PM
This was posted on Twitter yesterday. According to Professor Dolores Cahill the vaccines will cause your immune system to attack your own cells

A Thread from @dmills3710: "Dangerous Gene Therapy: Injecting  MRNA Into Every Cell of Your Body People become genetically organisms[...]"

Dangerous Gene Therapy: Injecting  MRNA Into Every Cell of Your Body

People become genetically organisms...

Professor Dolores Cahill: “Real adverse events will happen when the person comes across the virus in February or March or a year later...

rense.com/general96/mrna… (https://rense.com/general96/mrna.mp4)
https://pbs.twimg.com/media/EsxNTCzXIA816FA.jpg (https://pbs.twimg.com/media/EsxNTCzXIA816FA.jpg)




“That would be (time period) when 20% or 50% or all of the animals died in the study.

People over 80 for 1st vaccination: 2.5% or 1 in 40 have adverse events where they’re not able to function or live life normally.

For 2nd vaccination it could be 1 in 10. 80% will have life...
“limiting events when they come across the MRNA again. For the others it could be half.

What the gene therapy is doing is actually setting up an autoimmune disease chronically...
“1st vaccine: anaphylaxis (1st wave)

2nd vaccine: anaphylaxis allergic reaction (2nd wave)

3rd vaccine: reaction when you come across whatever the MRNA is against, you have stimulated your immune system to have low-grade autoimmune disease, not immunity (3rd wave)...
“but to yourself because the MRNA is expressing a viral protein.

You make yourself a genetically modified organism. So the immune system is meant to push the viruses out or the bacteria but you actually see it in your body...
“in yourself. The autoimmune disease is attacking yourself low-grade.

When you come across the virus, say in February or March, that stimulates the autoimmune system to get rid of the virus but then suddenly sees that you have virus protein in your cells, in your organs...
“your immune system attacks your own organs. You then, after about a week of that, you go into organ failure because your immune system is killing your own organs.

And those patients will present with sepsis infections for another week or two and then die from organ failure.”
You can follow @dmills3710 (https://twitter.com/intent/user?screen_name=dmills3710).

Share this threadBookmark____
Tip: mention @threader_app (https://twitter.com/intent/user?screen_name=threader_app) on a Twitter thread with the keyword “compile” to get a link to it.

Enjoy Threader? Sign up.

Since you’re here...

... we’re asking visitors like you to make a contribution to support this independent project. In these uncertain times, access to information is vital. Threader gets 1,000,000+ visits a month and our iOS Twitter client was featured as an App of the Day (https://threader.app/appoftheday) by Apple. Your financial support will help two developers to keep working on this app. Everyone’s contribution, big or small, is so valuable. Support Threader by becoming premium (https://threader.app/pricing) or by donating on PayPal (https://threader.app/donate). Thank you.

https://pbs.twimg.com/profile_images/926857336924397568/AB4-K0OD_mini.jpg

Dachsie
28th January 2021, 06:29 PM
The following is not posted to convey any helpful information about "coronavirus" but it does highlight the use of manipulated data and false statistics are very much used as leverage for political games.

New York has always been represented to have very high death rates from "the virus" and many of those deaths are of elderly people who were placed in nursing homes because of Governor Andrew Coumo's mandates and policies. The nursing homes' policy of not counting people who died after being transferred to a hospital from the nursing home is causing much controversy now.

So now the New York Attorney General has put out a report that claims that Coumo administration has actually under-reported the already high number of deaths from Covid by fifty percent. And on top of that, the New York Times newspaper was the first to publish this story and it is unusual for that entity to say anything negative Coumo.

Some say this is the end of Coumo's political career and that he will be out soon.

I have not delved into this story deeply so my brief summary may be faulty but it all looks like political vendetta games going on within the New York Democrat party machine.

___________________________________

https://www.nytimes.com/2021/01/28/nyregion/nursing-home-deaths-cuomo.html?referringSource=articleShare

N.Y. Severely Undercounted Virus Deaths in Nursing Homes, Report Says (https://www.nytimes.com/2021/01/28/nyregion/nursing-home-deaths-cuomo.html?referringSource=articleShare)


The state attorney general, Letitia James, said it’s likely that the Cuomo administration failed to report thousands of Covid-19 deaths of nursing home residents.

New York undercounted nursing home deaths by as much 50 percent, report finds

After the attorney general’s report was released, state health officials raised the number of Covid-19-related deaths connected to nursing homes by more than 3,800.Credit...Dave Sanders for The New York Times

By Jesse McKinley and Luis Ferré-Sadurní
• Jan. 28, 2021Updated 7:11 p.m. ET

ALBANY, N.Y. — For most of the past year, Gov. Andrew M. Cuomo has tried to brush away a persistent criticism that undermined his national image as the man who led New York through the pandemic: that his policies had allowed thousands of nursing home residents to die of the virus.

But Mr. Cuomo was dealt a blow when the New York State attorney general, Letitia James, reported on Thursday morning that Mr. Cuomo’s administration had undercounted coronavirus-related deaths of state nursing home residents by the thousands.

Just hours later, Ms. James was proved correct, as Health Department officials made public new data that added more than 3,800 deaths to their tally, representing nursing home residents who had died in hospitals and had not previously been counted by the state as nursing home deaths.

The state’s acknowledgment increased the overall death toll related to those facilities by more than 40 percent. Ms. James’s report had suggested that the state’s previous tally could be off by as much as 50 percent.

The findings do not change the overall number of Covid-19 deaths in New York — more than 42,000, the most of any state — but the recalculation in the number of nursing home deaths illustrates how unprepared the nursing home industry was in the first and deadliest weeks of the pandemic.

Mr. Cuomo, a third-term Democrat, had long dismissed the critiques of his policies governing those facilities as partisan attacks from the Trump administration and other Republican adversaries.

But the report by Ms. James, a fellow Democrat, casts a renewed light on the state’s decision to send nursing home residents who had been hospitalized with the coronavirus back to the nursing homes, a policy that Mr. Cuomo has defended as following federal guidelines.

At the same time, Ms. James’s assertion of an undercount of deaths gave credence to theories that the state may have intentionally played down the number of those deaths to avoid blame.

“This is shocking and unconscionable,” said Assemblyman Richard N. Gottfried, the Democratic chairman of the Assembly Health Committee. “But not surprising.”

The 76-page report, which included critiques of other policies promulgated by the Department of Health and of the behavior of nursing home operators, led to a scramble by Mr. Cuomo’s administration to rebut its assertions, including a lengthy response late Thursday afternoon from the health commissioner, Dr. Howard Zucker.

Dr. Zucker said that the state website had always been clear that deaths it listed did “not include deaths outside of a facility.”

“The word ‘undercount’ implies there are more total fatalities than have been reported,” he said. “This is factually wrong.”

He also asserted that the lack of data on hospital deaths of nursing home residents was due to concern and caution about the accuracy of data that nursing homes supplied — an issue also raised by the attorney general. “D.O.H. does not disagree that the number of people transferred from a nursing home to a hospital is an important data point,” he said.

The new data released by Dr. Zucker puts the total number of deaths connected to nursing homes at 12,743.

Ms. James’s findings would seem to put her in rare conflict with Mr. Cuomo; she was the governor’s preferred candidate after Eric T. Schneiderman suddenly resigned as attorney general in 2018, and she readily embraced Mr. Cuomo’s political backing.

Her report seemed certain to inspire more questions about the handling, oversight and performance of the state’s nursing homes in the early stages of the pandemic. Indeed, on Thursday, Mr. Cuomo’s critics in Washington and Albany had already seized on the attorney general’s report as evidence of his dishonesty, amid calls for Dr. Zucker to resign.

“This is now more than a nursing home scandal,” said Representative Elise Stefanik, a conservative Republican from upstate New York. “This is a massive corruption and cover-up scandal.”

Dachsie
29th January 2021, 05:55 AM
10 Reasons that SARS-CoV-2 Is an Imaginary and Theoretical Virus

https://ecp.yusercontent.com/mail?url=https%3A%2F%2F397145-1250082-raikfcquaxqncofqfm.stackpathdns.com%2Fwp-content%2Fuploads%2F2021%2F01%2Ftheoretical-virus.jpg&t=1611918513&ymreqid=cfc662b2-355b-9549-1c7c-b60028014200&sig=Fkn1KEJAxhhXqe8DZvn5nQ--~D

The Imaginary and Theoretical Virus known as SARS-CoV-2, a concept which has been used by the NWO (New World Order) controllers to shut down the world, is becoming more and more exposed as the months go by. Although those who believe in the COVID cult – both those orchestrating the scamdemic and those blindly following […] The post 10 Reasons that SARS-CoV-2 Is an Imaginary and Theoretical Virus appeared first on The Freedom Articles.

Published 5 hours ago on January 28, 2021
By Makia Freeman

https://thefreedomarticles.com/10-reasons-sars-cov-2-imaginary-digital-theoretical-virus/

10 Reasons that SARS-CoV-2 Is an Imaginary and Theoretical Virus (https://thefreedomarticles.com/10-reasons-sars-cov-2-imaginary-digital-theoretical-virus/)


AT A GLANCE...

THE STORY:

No record found: the SARS-CoV-2 virus that allegedly causes COVID has still, to this date, never been isolated. Countless governments and organizations worldwide have failed to produce evidence of its existence when challenged.
THE IMPLICATIONS:

The world has been shut down and people's lives have been decimated over a lie and a superstition that could well be the biggest fraud ever perpetuated on humanity as a whole.



The Imaginary and Theoretical Virus

known as SARS-CoV-2, a concept which has been used by the NWO (New World Order) controllers to shut down the world, is becoming more and more exposed as the months go by. Although those who believe in the COVID cult – both those orchestrating the scamdemic and those blindly following along – will insist the virus is real, the truth is that there has still been no compelling or conclusive evidence that a real SARS-CoV-2 virus exists. Admissions by governmental scientists and organizations worldwide, as well as omissions and obfuscations by those same people and agencies, reveal the shocking truth. As hard as it may be for the COVID cultists to admit, the emperor truly has no clothes. There is no virus, other than a digital, theoretical abstraction made on a computer from a genomic database. The virus has never been isolated, purified, sequenced, characterized and proven 100% to exist. Don’t believe it? That’s okay; it’s good to be skeptical. See the evidence below for yourself and make up your own mind.

#1 SARS-CoV-2 the Theoretical Virus: The Virus Has Never Been Isolated According to Koch’s Postulates or River’s Postulates

We’ll start with this, because this is the cornerstone of the whole scam. All the following information and evidence below stems from the fact the so-called experts have never isolated and purified the virus according to the gold standard of Koch’s postulates, or even the modified River’s Postulates. Koch’s postulates are:

The microorganism must be identified in all individuals affected by the disease, but not in healthy individuals.
The microorganism can be isolated from the diseased individual and grown in culture.
When introduced into a healthy individual, the cultured microorganism must cause disease.
The microorganism must then be re-isolated from the experimental host, and found to be identical to the original microorganism.

River’s postulates were proposed by Thomas M. River in 1973 to establish the role of a specific virus as the cause of a specific disease. They are modifications of Koch’s postulates. They are as follows:

The viral agent must be found either in the host’s (animal or plant) body fluids at the time of disease or in cells showing lesions specific to that disease.
The host material with the viral agent used to inoculate the healthy host (test organism) must be free of any other microorganism.
The viral agent obtained from the infected host must produce the specific disease in a suitable healthy host, and/or provide evidence of infection by inducing the formation of antibodies specific to that agent.
Similar material (viral particle) from the newly infected host (test organism) must be isolated and capable of transmitting the specific disease to other healthy hosts.

Whichever set of postulates is used, SARS-CoV-2 fails the test. Dr. Andrew Kaufman does a great job explaining why in this video. The coronavirus SARS-CoV-2 (allegedly causing the disease COVID-19) has not been shown to be present only in sick people and not in healthy ones. The virus has never been isolated, which must be done with proper equipment such as electron microscopes and which cannot be achieved through CT scans (as the Chinese were using) and the flawed PCR test. The January 24th 2020 study published in the New England Journal of Medicine entitled A Novel Coronavirus from Patients with Pneumonia in China, 2019 describes how the scientists arrived at the idea of COVID-19: they took lung fluid samples and extracted RNA from them using the PCR test. It admits that the coronavirus failed Koch’s postulates:

“Further development of accurate and rapid methods to identify unknown respiratory pathogens is still needed … our study does not fulfill Koch’s postulates.”


#2 SARS-CoV-2 the Theoretical Virus: Top Chinese Scientist Admitted They Never Isolated the Virus

All claims that the SARS-CoV-2 virus has been isolated have turned out to be unsubstantiated. Meanwhile, there have been actual admissions by officials that they haven’t isolated it. The chief epidemiologist of the Chinese CDC (Center for Disease Control) admitted “they didn’t isolate the virus” in this video clip.

#3 SARS-CoV-2 the Theoretical Virus: CDC Stated No Quantified Isolate Was Available

The US CDC (Centers for Disease Control and Prevention) in its July 2020 report CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel admits that it had been running PCR tests based not on an actual viral isolate (an actual sample or specimen taken from an infected human), but rather “stocks” of “transcribed RNA” taken from a gene bank to “mimic clinical specimen”:

“Since no quantified virus isolates of the 2019-nCoV were available for CDC use at the time the test was developed and this study conducted, assays designed for detection of the 2019-nCoV RNA were tested with characterized stocks of in vitro transcribed full length RNA (N gene; GenBank accession: MN908947.2) of known titer (RNA copies/μL) spiked into a diluent consisting of a suspension of human A549 cells and viral transport medium (VTM) to mimic clinical specimen.” (pg.43)

#4 SARS-CoV-2 the Theoretical Virus: CDC Admitted They Made a Digital Virus of 30,000 Base Pairs Using 37 Actual Sample Base Pairs

As covered in my previous article SARS-CoV-2: The Stitched Together, Frankenstein Virus, the CDC has already admitted that SARS-CoV-2 is a computer-generated digital virus, not a real living virus. As I wrote:

“In other words, it is a Frankenstein virus which has been concocted and stitched together using genomic database sequences (some viral, some not). It has never been properly purified and isolated so that it could be sequenced from end-to-end once derived from living tissue; instead, it’s just digitally assembled from a computer database. In this paper, the CDC scientists state they took just 37 base pairs from a genome of 30,000 base pairs which means that about 0.001% of the viral sequence is derived from actual living samples or real bodily tissue. In other words, they took these 37 segments and put them into a computer program, which filled in the rest of the base pairs. This computer-generation step constitutes scientific fraud.”

In this article In June Study CDC Scientists Make 2 COVID Admissions that Destroy Official Narrative I reveal how the CDC admitted in their paper that they extrapolated their make-believe virus. Here is the quote:

“Whole-Genome Sequencing

We designed 37 pairs of nested PCRs spanning the genome on the basis of the coronavirus reference sequence (GenBank accession no. NC045512). We extracted nucleic acid from isolates and amplified by using the 37 individual nested PCRs.”

Another way to say this is that the “virus” has been constructed using a technique called de novo assembly which is a method for constructing genomes from a large number of (short or long) DNA fragments, with no a priori knowledge of the correct sequence or order of those fragments. You can read more about it here.

#5 SARS-CoV-2 the Theoretical Virus: European Corman-Drosten Paper Used an “In Silico” Genome of an “In Silico” Virus

The original Corman-Drosten paper admits they used a theoretical virus sequence for all their work and calculations. They, like the CDC and every government and agency, claim this is only because no isolate was ever available. I wonder if any of these scientists every asked WHY the isolate has never been available?

“In the present case of 2019-nCoV, virus isolates or samples from infected patients have so far not become available to the international public health community.”


A subsequent study highlighting fatal flaws in the Corman-Drosten paper was published entitled External peer review of the RTPCR test to detect SARS-CoV-2 reveals 10 major scientific flaws at the molecular and methodological level: consequences for false positive results. It highlights how the authors used in silico or theoretical sequences from computer banks, not real isolated samples from infected people. “In silico” is pseudo-Latin for “theoretical”; in plain English, synonyms for theoretical are “imaginary” and “make-believe.”

“The first and major issue is that the novel Coronavirus SARS-CoV-2 (in the publication named 2019-nCoV and in February 2020 named SARS-CoV-2 by an international consortium of virus experts) is based on in silico (theoretical) sequences, supplied by a laboratory in China, because at the time neither control material of infectious (“live”) or inactivated SARS-CoV-2 nor isolated genomic RNA of the virus was available to the authors. To date no validation has been performed by the authorship based on isolated SARS-CoV-2 viruses or full length RNA thereof.



Nevertheless these in silico sequences were used to develop a RT-PCR test methodology to identify the aforesaid virus. This model was based on the assumption that the novel virus is very similar to SARS-CoV from 2003 (Hereafter named SARS-CoV-1) as both are beta-coronaviruses … in short, a design relying merely on close genetic relatives does not fulfill the aim for a “robust diagnostic test” as cross reactivity and therefore false-positive results will inevitably occur. Validation was only done in regards to in silico (theoretical) sequences and within the laboratory-setting, and not as required for in-vitro diagnostics with isolated genomic viral RNA. This very fact hasn’t changed even after 10 months of introduction of the test into routine diagnostics.”

#6 SARS-CoV-2 the Theoretical Virus: UK Government Couldn’t Produce Evidence

The governments of many nations around the world couldn’t seem to come up with a real virus either when challenged to do so. More evidence proving the “virus” is constructed on a computer database from a digital gene bank comes from Frances Leader, who questioned the UK MHRA (Medicines and Healthcare products Regulatory Agency) whether a real isolated virus was used to make the COVID vax (read more about the COVID vaccine which is not a vaccine here). Leader found that the WHO protocols that Pfizer used to produce the mRNA do not appear to identify any nucleotide sequences that are unique to the SARS-CoV-2 virus. Leader asked if the “virus” was actually a computer generated genomic sequence, and ultimately the MHRA confirmed they had no real specimen:

“The DNA template does not come directly from an isolated virus from an infected person.”

n July 2020, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in which they asked him to produce independently peer reviewed scientific evidence proving that the SARS-CoV-2 “virus” has been isolated. To date they have not received a reply. Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England (PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus to which they responded:


“PHE can confirm it does not hold information in the way suggested by your request.”

#7 SARS-CoV-2 the Theoretical Virus: Australian Government Couldn’t Produce Evidence

In other Commonwealth nations it’s the exact same story. In Australia scientists from the Doherty Institute falsely announced that they had isolated the SARS-CoV-2 virus. When asked to clarify the scientists said:

“We have short (RNA) sequences from the diagnostic test that can be used in the diagnostic tests.”

Perhaps this is the reason for this disclaimer by the Australian Government:



“The reliability of COVID-19 tests is uncertain due to the limited evidence base…There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”

#8 SARS-CoV-2 the Theoretical Virus: Canadian Government Couldn’t Produce Evidence

Researcher Christine Massey made a similar Freedom of Information request in Canada, to which the Canadian Government replied:

“Having completed a thorough search, we regret to inform you that we were unable to locate any records responsive to your request.”

#9 SARS-Cov-2 the Theoretical Virus: Over 40 Institutions Worldwide Can’t Answer the Basic Question

In fact, Massey and her colleague in New Zealand “have been submitting Freedom of Information requests to various institutions in Canada, NZ, Australia, Germany, the U.K., the U.S. etc., seeking any records that describe the isolation of a “COVID-19 virus” (aka “SARS-COV-2”) from an unadulterated sample taken from a diseased human … As of December 16, 2020, >40 institutions in Canada, U.S., New Zealand, Australia, U.K., England, Scotland, Wales, Ireland, Denmark, and the European CDC have provided their responses, and none could locate any record describing the isolation of any “COVID-19 virus” aka “SARS-COV-2” directly from a diseased patient.”

Massey posts their replies here and here.

#10 SARS-Cov-2 the Theoretical Virus: Previous Coronaviruses Have Not Been Isolated

The Spanish health journal Salud published a great article in November 2020 entitled “Frauds and falsehoods in the medical field” where it exposes the lack of evidence not only for the isolation of SARS-CoV-2, but also for the isolation of other past coronaviruses (unofficial translation here). The scam runs deep. Jon Rappoport has done great work exposing how the exact same scam blueprint was played out in the 1980s (with Fauci in charge, leading the fraud) when scientists asserted there was a new virus called HIV, and it was causing AIDS. The COVID scamdemic greatly mimics other historical fake pandemics such as the 1976 swine flu pandemic. The article is Salud states:

“The genetic sequences used in PCRs to detect suspected SARS-CoV-2 and to diagnose cases of illness and death attributed to Covid-19 are present in dozens of sequences of the human genome itself and in those of about a hundred microbes. And that includes the initiators or primers, the most extensive fragments taken at random from their supposed “genome” and even the so-called “target genes” allegedly specific to the “new coronavirus”. The test is worthless and all “positive” results obtained so far should be scientifically invalidated and communicated to those affected; and if they are deceased, to their relatives. Stephen Bustin, one of the world’s leading experts on PCR, in fact says that under certain conditions anyone can test positive!



We have been warning you since March [2020 – Ed.]: you cannot have specific tests for a virus without knowing the components of the virus you are trying to detect. And the components cannot be known without having previously isolated/purified that virus. Since then we continue to accumulate evidence that no one has isolated SARS-CoV-2 and, more importantly, that it can never be isolated … In this report we are going to add the results of a particular research we have done from the data published on the alleged SARS-CoV-2 and on the protocols endorsed by the WHO for the use of RT-PCR as well as the data corresponding to the rest of the “human coronaviruses”. And the conclusions are extremely serious: none of the seven “human coronaviruses” have actually been isolated and all the sequences of the primers of their respective PCRs as well as those of a large number of fragments of their supposed genomes are found in different areas of the human genome and in genomes of bacteria and archaea …”

Their report analyzed human coronaviruses 229E (said to have been isolated in 1965), OC43 (in 1967), SARS-CoV (in 2003), NL63 (in 2004), HKU1 (in 2005) and MERS-CoV (in 2012). And just to repeat in case you missed it: they discovered the alleged sequences of SARS-CoV-2 are found in both humans and bacteria! This means all the various in silico models of SARS-CoV-2 contain existing human genetic sequences, so it is little wonder that people test positive when the primer or standard being tested against contains human sequences.

Conclusion: The COVID Cult is a Colossal Fraud and Superstition

How did this all start? Chinese scientists took lung fluid samples and claimed they had discovered a novel or new virus. The Gates-Rockefeller WHO backed them up. In the WHO’s Novel Coronavirus 2019-nCov Situation Report 1, they state:

“The Chinese authorities identified a new type of coronavirus, which was isolated on 7 January 2020……On 12 January 2020, China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”

With the evidence presented above, the WHO’s assertions and claims are utterly baseless. They constitute outright fraud. The world has been shut down over a lie – a coldly calculated, carefully curated lie – that was simulated and war-gamed for decades in advance. The COVID cult is an irrational superstition based on nothing but in silico, theoretical, make-believe viral sequences. Yet, the real-world consequences for millions who have been thrown into stress, despair, poverty, joblessness, alcoholism and suicide is anything but theoretical.

*****

Makia Freeman is the editor of alternative media / independent news site The Freedom Articles, author of the book Cancer: The Lies, the Truth and the Solutions and senior researcher at ToolsForFreedom.com. Makia is on Steemit and Parler.

Sources:

*https://thefreedomarticles.com/covid-19-umbrella-term-fake-pandemic-not-1-disease-cause/

*https://paramedicsworld.com/virology-notes/introduction-to-virology-rivers-postulates/medical-paramedical-studynotes

*https://www.bitchute.com/video/eOGvhrGTVq6N/

*https://www.nejm.org/doi/full/10.1056/NEJMoa2001017

*https://twitter.com/EEccetera/status/1354208913315528705

*https://www.fda.gov/media/134922/download

*https://thefreedomarticles.com/sars-cov-2-stitched-together-frankenstein-virus/

*https://thefreedomarticles.com/covid-admissions-cdc-scientists-accidentally-destroy-official-narrative/

*https://wwwnc.cdc.gov/eid/article/26/6/20-0516_article

*https://thesequencingcenter.com/knowledge-base/de-novo-assembly/

*https://www.eurosurveillance.org/content/10.2807/1560-7917.ES.2020.25.3.2000045

*https://www.researchgate.net/publication/346483715_External_peer_review_of_the_RTPCR_test_t o_detect_SARS-CoV-2_reveals_10_major_scientific_flaws_at_the_molecul ar_and_methodological_level_consequences_for_false _positive_results

*https://hive.blog/worldnews/@francesleader/email-exchange-with-uk-mhra-exposing-the-genomic-sequence-of-sarscov2

*https://thefreedomarticles.com/not-a-vaccine-mrna-covid-vaccine-chemical-pathogen-device/

*https://www.resetourplanet.com/covid19-something-real-or-fake-what-do-we-know/

*https://cvpandemicinvestigation.com/2020/09/covid-19-evidence-of-fraud-medical-malpractice-acts-of-domestic-terrorism-and-breaches-of-human-rights/#_Toc56846502

*https://www.whatdotheyknow.com/request/679566/response/1625332/attach/html/2/872%20FOI%20All%20records%20describing%20isolation %20of%20SARS%20COV%202.pdf.html

*https://www.doherty.edu.au/people

*https://twitter.com/TheDohertyInst/status/1222345640769777671

*https://www.tga.gov.au/covid-19-testing-australia-information-health-professionals

*https://www.fluoridefreepeel.ca/wp-content/uploads/2020/06/Health-Canada-FinalResponse-A-2020-00208-2020-06-13.pdf

*https://www.fluoridefreepeel.ca/wp-content/uploads/2020/10/FOI-and-formal-responses-re-covid19-virus-isolation-purification-from-19-institutions-Oct-10-2020.pdf

*https://www.fluoridefreepeel.ca/fois-reveal-that-health-science-institutions-around-the-world-have-no-record-of-sars-cov-2-isolation-purification/

*https://ia801704.us.archive.org/6/items/the-scam-has-been-confirmed-pcr-does-not-detect-sars-cov-2/The%20scam%20has%20been%20confirmed%20-%20Dsalud%20November%202020.pdf

*https://thefreedomarticles.com/same-fake-pandemic-similarities-1976-swine-flu-2020-covid/

*https://apps.who.int/iris/bitstream/handle/10665/330760/nCoVsitrep21Jan2020-eng.pdf?sequence=3&isAllowed=y

*https://off-guardian.org/2020/11/17/covid19-evidence-of-global-fraud/

Dachsie
29th January 2021, 05:55 AM
10 Reasons that SARS-CoV-2 Is an Imaginary and Theoretical Virus

https://ecp.yusercontent.com/mail?url=https%3A%2F%2F397145-1250082-raikfcquaxqncofqfm.stackpathdns.com%2Fwp-content%2Fuploads%2F2021%2F01%2Ftheoretical-virus.jpg&t=1611918513&ymreqid=cfc662b2-355b-9549-1c7c-b60028014200&sig=Fkn1KEJAxhhXqe8DZvn5nQ--~D

The Imaginary and Theoretical Virus known as SARS-CoV-2, a concept which has been used by the NWO (New World Order) controllers to shut down the world, is becoming more and more exposed as the months go by. Although those who believe in the COVID cult – both those orchestrating the scamdemic and those blindly following […] The post 10 Reasons that SARS-CoV-2 Is an Imaginary and Theoretical Virus appeared first on The Freedom Articles.

Published 5 hours ago on January 28, 2021
By Makia Freeman

https://thefreedomarticles.com/10-reasons-sars-cov-2-imaginary-digital-theoretical-virus/

10 Reasons that SARS-CoV-2 Is an Imaginary and Theoretical Virus (https://thefreedomarticles.com/10-reasons-sars-cov-2-imaginary-digital-theoretical-virus/)


AT A GLANCE...

THE STORY:

No record found: the SARS-CoV-2 virus that allegedly causes COVID has still, to this date, never been isolated. Countless governments and organizations worldwide have failed to produce evidence of its existence when challenged.
THE IMPLICATIONS:

The world has been shut down and people's lives have been decimated over a lie and a superstition that could well be the biggest fraud ever perpetuated on humanity as a whole.



The Imaginary and Theoretical Virus

known as SARS-CoV-2, a concept which has been used by the NWO (New World Order) controllers to shut down the world, is becoming more and more exposed as the months go by. Although those who believe in the COVID cult – both those orchestrating the scamdemic and those blindly following along – will insist the virus is real, the truth is that there has still been no compelling or conclusive evidence that a real SARS-CoV-2 virus exists. Admissions by governmental scientists and organizations worldwide, as well as omissions and obfuscations by those same people and agencies, reveal the shocking truth. As hard as it may be for the COVID cultists to admit, the emperor truly has no clothes. There is no virus, other than a digital, theoretical abstraction made on a computer from a genomic database. The virus has never been isolated, purified, sequenced, characterized and proven 100% to exist. Don’t believe it? That’s okay; it’s good to be skeptical. See the evidence below for yourself and make up your own mind.

#1 SARS-CoV-2 the Theoretical Virus: The Virus Has Never Been Isolated According to Koch’s Postulates or River’s Postulates

We’ll start with this, because this is the cornerstone of the whole scam. All the following information and evidence below stems from the fact the so-called experts have never isolated and purified the virus according to the gold standard of Koch’s postulates, or even the modified River’s Postulates. Koch’s postulates are:

The microorganism must be identified in all individuals affected by the disease, but not in healthy individuals.
The microorganism can be isolated from the diseased individual and grown in culture.
When introduced into a healthy individual, the cultured microorganism must cause disease.
The microorganism must then be re-isolated from the experimental host, and found to be identical to the original microorganism.

River’s postulates were proposed by Thomas M. River in 1973 to establish the role of a specific virus as the cause of a specific disease. They are modifications of Koch’s postulates. They are as follows:

The viral agent must be found either in the host’s (animal or plant) body fluids at the time of disease or in cells showing lesions specific to that disease.
The host material with the viral agent used to inoculate the healthy host (test organism) must be free of any other microorganism.
The viral agent obtained from the infected host must produce the specific disease in a suitable healthy host, and/or provide evidence of infection by inducing the formation of antibodies specific to that agent.
Similar material (viral particle) from the newly infected host (test organism) must be isolated and capable of transmitting the specific disease to other healthy hosts.

Whichever set of postulates is used, SARS-CoV-2 fails the test. Dr. Andrew Kaufman does a great job explaining why in this video. The coronavirus SARS-CoV-2 (allegedly causing the disease COVID-19) has not been shown to be present only in sick people and not in healthy ones. The virus has never been isolated, which must be done with proper equipment such as electron microscopes and which cannot be achieved through CT scans (as the Chinese were using) and the flawed PCR test. The January 24th 2020 study published in the New England Journal of Medicine entitled A Novel Coronavirus from Patients with Pneumonia in China, 2019 describes how the scientists arrived at the idea of COVID-19: they took lung fluid samples and extracted RNA from them using the PCR test. It admits that the coronavirus failed Koch’s postulates:

“Further development of accurate and rapid methods to identify unknown respiratory pathogens is still needed … our study does not fulfill Koch’s postulates.”


#2 SARS-CoV-2 the Theoretical Virus: Top Chinese Scientist Admitted They Never Isolated the Virus

All claims that the SARS-CoV-2 virus has been isolated have turned out to be unsubstantiated. Meanwhile, there have been actual admissions by officials that they haven’t isolated it. The chief epidemiologist of the Chinese CDC (Center for Disease Control) admitted “they didn’t isolate the virus” in this video clip.

#3 SARS-CoV-2 the Theoretical Virus: CDC Stated No Quantified Isolate Was Available

The US CDC (Centers for Disease Control and Prevention) in its July 2020 report CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel admits that it had been running PCR tests based not on an actual viral isolate (an actual sample or specimen taken from an infected human), but rather “stocks” of “transcribed RNA” taken from a gene bank to “mimic clinical specimen”:

“Since no quantified virus isolates of the 2019-nCoV were available for CDC use at the time the test was developed and this study conducted, assays designed for detection of the 2019-nCoV RNA were tested with characterized stocks of in vitro transcribed full length RNA (N gene; GenBank accession: MN908947.2) of known titer (RNA copies/μL) spiked into a diluent consisting of a suspension of human A549 cells and viral transport medium (VTM) to mimic clinical specimen.” (pg.43)

#4 SARS-CoV-2 the Theoretical Virus: CDC Admitted They Made a Digital Virus of 30,000 Base Pairs Using 37 Actual Sample Base Pairs

As covered in my previous article SARS-CoV-2: The Stitched Together, Frankenstein Virus, the CDC has already admitted that SARS-CoV-2 is a computer-generated digital virus, not a real living virus. As I wrote:

“In other words, it is a Frankenstein virus which has been concocted and stitched together using genomic database sequences (some viral, some not). It has never been properly purified and isolated so that it could be sequenced from end-to-end once derived from living tissue; instead, it’s just digitally assembled from a computer database. In this paper, the CDC scientists state they took just 37 base pairs from a genome of 30,000 base pairs which means that about 0.001% of the viral sequence is derived from actual living samples or real bodily tissue. In other words, they took these 37 segments and put them into a computer program, which filled in the rest of the base pairs. This computer-generation step constitutes scientific fraud.”

In this article In June Study CDC Scientists Make 2 COVID Admissions that Destroy Official Narrative I reveal how the CDC admitted in their paper that they extrapolated their make-believe virus. Here is the quote:

“Whole-Genome Sequencing

We designed 37 pairs of nested PCRs spanning the genome on the basis of the coronavirus reference sequence (GenBank accession no. NC045512). We extracted nucleic acid from isolates and amplified by using the 37 individual nested PCRs.”

Another way to say this is that the “virus” has been constructed using a technique called de novo assembly which is a method for constructing genomes from a large number of (short or long) DNA fragments, with no a priori knowledge of the correct sequence or order of those fragments. You can read more about it here.

#5 SARS-CoV-2 the Theoretical Virus: European Corman-Drosten Paper Used an “In Silico” Genome of an “In Silico” Virus

The original Corman-Drosten paper admits they used a theoretical virus sequence for all their work and calculations. They, like the CDC and every government and agency, claim this is only because no isolate was ever available. I wonder if any of these scientists every asked WHY the isolate has never been available?

“In the present case of 2019-nCoV, virus isolates or samples from infected patients have so far not become available to the international public health community.”


A subsequent study highlighting fatal flaws in the Corman-Drosten paper was published entitled External peer review of the RTPCR test to detect SARS-CoV-2 reveals 10 major scientific flaws at the molecular and methodological level: consequences for false positive results. It highlights how the authors used in silico or theoretical sequences from computer banks, not real isolated samples from infected people. “In silico” is pseudo-Latin for “theoretical”; in plain English, synonyms for theoretical are “imaginary” and “make-believe.”

“The first and major issue is that the novel Coronavirus SARS-CoV-2 (in the publication named 2019-nCoV and in February 2020 named SARS-CoV-2 by an international consortium of virus experts) is based on in silico (theoretical) sequences, supplied by a laboratory in China, because at the time neither control material of infectious (“live”) or inactivated SARS-CoV-2 nor isolated genomic RNA of the virus was available to the authors. To date no validation has been performed by the authorship based on isolated SARS-CoV-2 viruses or full length RNA thereof.



Nevertheless these in silico sequences were used to develop a RT-PCR test methodology to identify the aforesaid virus. This model was based on the assumption that the novel virus is very similar to SARS-CoV from 2003 (Hereafter named SARS-CoV-1) as both are beta-coronaviruses … in short, a design relying merely on close genetic relatives does not fulfill the aim for a “robust diagnostic test” as cross reactivity and therefore false-positive results will inevitably occur. Validation was only done in regards to in silico (theoretical) sequences and within the laboratory-setting, and not as required for in-vitro diagnostics with isolated genomic viral RNA. This very fact hasn’t changed even after 10 months of introduction of the test into routine diagnostics.”

#6 SARS-CoV-2 the Theoretical Virus: UK Government Couldn’t Produce Evidence

The governments of many nations around the world couldn’t seem to come up with a real virus either when challenged to do so. More evidence proving the “virus” is constructed on a computer database from a digital gene bank comes from Frances Leader, who questioned the UK MHRA (Medicines and Healthcare products Regulatory Agency) whether a real isolated virus was used to make the COVID vax (read more about the COVID vaccine which is not a vaccine here). Leader found that the WHO protocols that Pfizer used to produce the mRNA do not appear to identify any nucleotide sequences that are unique to the SARS-CoV-2 virus. Leader asked if the “virus” was actually a computer generated genomic sequence, and ultimately the MHRA confirmed they had no real specimen:

“The DNA template does not come directly from an isolated virus from an infected person.”

n July 2020, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in which they asked him to produce independently peer reviewed scientific evidence proving that the SARS-CoV-2 “virus” has been isolated. To date they have not received a reply. Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England (PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus to which they responded:


“PHE can confirm it does not hold information in the way suggested by your request.”

#7 SARS-CoV-2 the Theoretical Virus: Australian Government Couldn’t Produce Evidence

In other Commonwealth nations it’s the exact same story. In Australia scientists from the Doherty Institute falsely announced that they had isolated the SARS-CoV-2 virus. When asked to clarify the scientists said:

“We have short (RNA) sequences from the diagnostic test that can be used in the diagnostic tests.”

Perhaps this is the reason for this disclaimer by the Australian Government:



“The reliability of COVID-19 tests is uncertain due to the limited evidence base…There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”

#8 SARS-CoV-2 the Theoretical Virus: Canadian Government Couldn’t Produce Evidence

Researcher Christine Massey made a similar Freedom of Information request in Canada, to which the Canadian Government replied:

“Having completed a thorough search, we regret to inform you that we were unable to locate any records responsive to your request.”

#9 SARS-Cov-2 the Theoretical Virus: Over 40 Institutions Worldwide Can’t Answer the Basic Question

In fact, Massey and her colleague in New Zealand “have been submitting Freedom of Information requests to various institutions in Canada, NZ, Australia, Germany, the U.K., the U.S. etc., seeking any records that describe the isolation of a “COVID-19 virus” (aka “SARS-COV-2”) from an unadulterated sample taken from a diseased human … As of December 16, 2020, >40 institutions in Canada, U.S., New Zealand, Australia, U.K., England, Scotland, Wales, Ireland, Denmark, and the European CDC have provided their responses, and none could locate any record describing the isolation of any “COVID-19 virus” aka “SARS-COV-2” directly from a diseased patient.”

Massey posts their replies here and here.

#10 SARS-Cov-2 the Theoretical Virus: Previous Coronaviruses Have Not Been Isolated

The Spanish health journal Salud published a great article in November 2020 entitled “Frauds and falsehoods in the medical field” where it exposes the lack of evidence not only for the isolation of SARS-CoV-2, but also for the isolation of other past coronaviruses (unofficial translation here). The scam runs deep. Jon Rappoport has done great work exposing how the exact same scam blueprint was played out in the 1980s (with Fauci in charge, leading the fraud) when scientists asserted there was a new virus called HIV, and it was causing AIDS. The COVID scamdemic greatly mimics other historical fake pandemics such as the 1976 swine flu pandemic. The article is Salud states:

“The genetic sequences used in PCRs to detect suspected SARS-CoV-2 and to diagnose cases of illness and death attributed to Covid-19 are present in dozens of sequences of the human genome itself and in those of about a hundred microbes. And that includes the initiators or primers, the most extensive fragments taken at random from their supposed “genome” and even the so-called “target genes” allegedly specific to the “new coronavirus”. The test is worthless and all “positive” results obtained so far should be scientifically invalidated and communicated to those affected; and if they are deceased, to their relatives. Stephen Bustin, one of the world’s leading experts on PCR, in fact says that under certain conditions anyone can test positive!



We have been warning you since March [2020 – Ed.]: you cannot have specific tests for a virus without knowing the components of the virus you are trying to detect. And the components cannot be known without having previously isolated/purified that virus. Since then we continue to accumulate evidence that no one has isolated SARS-CoV-2 and, more importantly, that it can never be isolated … In this report we are going to add the results of a particular research we have done from the data published on the alleged SARS-CoV-2 and on the protocols endorsed by the WHO for the use of RT-PCR as well as the data corresponding to the rest of the “human coronaviruses”. And the conclusions are extremely serious: none of the seven “human coronaviruses” have actually been isolated and all the sequences of the primers of their respective PCRs as well as those of a large number of fragments of their supposed genomes are found in different areas of the human genome and in genomes of bacteria and archaea …”

Their report analyzed human coronaviruses 229E (said to have been isolated in 1965), OC43 (in 1967), SARS-CoV (in 2003), NL63 (in 2004), HKU1 (in 2005) and MERS-CoV (in 2012). And just to repeat in case you missed it: they discovered the alleged sequences of SARS-CoV-2 are found in both humans and bacteria! This means all the various in silico models of SARS-CoV-2 contain existing human genetic sequences, so it is little wonder that people test positive when the primer or standard being tested against contains human sequences.

Conclusion: The COVID Cult is a Colossal Fraud and Superstition

How did this all start? Chinese scientists took lung fluid samples and claimed they had discovered a novel or new virus. The Gates-Rockefeller WHO backed them up. In the WHO’s Novel Coronavirus 2019-nCov Situation Report 1, they state:

“The Chinese authorities identified a new type of coronavirus, which was isolated on 7 January 2020……On 12 January 2020, China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”

With the evidence presented above, the WHO’s assertions and claims are utterly baseless. They constitute outright fraud. The world has been shut down over a lie – a coldly calculated, carefully curated lie – that was simulated and war-gamed for decades in advance. The COVID cult is an irrational superstition based on nothing but in silico, theoretical, make-believe viral sequences. Yet, the real-world consequences for millions who have been thrown into stress, despair, poverty, joblessness, alcoholism and suicide is anything but theoretical.

*****

Makia Freeman is the editor of alternative media / independent news site The Freedom Articles, author of the book Cancer: The Lies, the Truth and the Solutions and senior researcher at ToolsForFreedom.com. Makia is on Steemit and Parler.

Sources:

*https://thefreedomarticles.com/covid-19-umbrella-term-fake-pandemic-not-1-disease-cause/

*https://paramedicsworld.com/virology-notes/introduction-to-virology-rivers-postulates/medical-paramedical-studynotes

*https://www.bitchute.com/video/eOGvhrGTVq6N/

*https://www.nejm.org/doi/full/10.1056/NEJMoa2001017

*https://twitter.com/EEccetera/status/1354208913315528705

*https://www.fda.gov/media/134922/download

*https://thefreedomarticles.com/sars-cov-2-stitched-together-frankenstein-virus/

*https://thefreedomarticles.com/covid-admissions-cdc-scientists-accidentally-destroy-official-narrative/

*https://wwwnc.cdc.gov/eid/article/26/6/20-0516_article

*https://thesequencingcenter.com/knowledge-base/de-novo-assembly/

*https://www.eurosurveillance.org/content/10.2807/1560-7917.ES.2020.25.3.2000045

*https://www.researchgate.net/publication/346483715_External_peer_review_of_the_RTPCR_test_t o_detect_SARS-CoV-2_reveals_10_major_scientific_flaws_at_the_molecul ar_and_methodological_level_consequences_for_false _positive_results

*https://hive.blog/worldnews/@francesleader/email-exchange-with-uk-mhra-exposing-the-genomic-sequence-of-sarscov2

*https://thefreedomarticles.com/not-a-vaccine-mrna-covid-vaccine-chemical-pathogen-device/

*https://www.resetourplanet.com/covid19-something-real-or-fake-what-do-we-know/

*https://cvpandemicinvestigation.com/2020/09/covid-19-evidence-of-fraud-medical-malpractice-acts-of-domestic-terrorism-and-breaches-of-human-rights/#_Toc56846502

*https://www.whatdotheyknow.com/request/679566/response/1625332/attach/html/2/872%20FOI%20All%20records%20describing%20isolation %20of%20SARS%20COV%202.pdf.html

*https://www.doherty.edu.au/people

*https://twitter.com/TheDohertyInst/status/1222345640769777671

*https://www.tga.gov.au/covid-19-testing-australia-information-health-professionals

*https://www.fluoridefreepeel.ca/wp-content/uploads/2020/06/Health-Canada-FinalResponse-A-2020-00208-2020-06-13.pdf

*https://www.fluoridefreepeel.ca/wp-content/uploads/2020/10/FOI-and-formal-responses-re-covid19-virus-isolation-purification-from-19-institutions-Oct-10-2020.pdf

*https://www.fluoridefreepeel.ca/fois-reveal-that-health-science-institutions-around-the-world-have-no-record-of-sars-cov-2-isolation-purification/

*https://ia801704.us.archive.org/6/items/the-scam-has-been-confirmed-pcr-does-not-detect-sars-cov-2/The%20scam%20has%20been%20confirmed%20-%20Dsalud%20November%202020.pdf

*https://thefreedomarticles.com/same-fake-pandemic-similarities-1976-swine-flu-2020-covid/

*https://apps.who.int/iris/bitstream/handle/10665/330760/nCoVsitrep21Jan2020-eng.pdf?sequence=3&isAllowed=y

*https://off-guardian.org/2020/11/17/covid19-evidence-of-global-fraud/

Dachsie
29th January 2021, 06:07 PM
https://www.youtube.com/watch?v=hMb6Lm9DSQg&feature=emb_err_woyt

2 hour show simulcast on Revolution Radio https://revolution.radio/

and YouTube

The Perfect Triangle show hosted by Giuseppe Favanculo - often with Scorpio and Chris Weinert

Guests today are Dr. Carrie Madej, M.D. (Internal Medicine) and Maryam Henein

The Perfect Triangle Episode 29 - 29 January 2021
34 watching now
•Started streaming 2 hours ago
17
0
Share
Save
Rising TideMedia
193 subscribers
Giuseppe, Scorpio & Brutal Honesty Chris Weinert are joined by guests:
Dr Carrie Madej @DrMadej - gifted healer; health/freedom hero!
Maryam Henein @MaryamHenein - muckraking journalist; natural health expert.

Dachsie
29th January 2021, 06:14 PM
https://www.lifesitenews.com/news/39-year-old-nurse-aide-dies-within-48-hours-of-receiving-mandated-covid-19-shot

News
39-year-old nurse aide dies ‘within 48 hours’ of receiving mandated COVID-19 shot
‘She was coming home from work and as soon as she drove into her parking lot she passed away,’ Janet L. Moore’s brother Jacob Gregory told LifeSiteNews.
Wed Jan 27, 2021 - 3:16 pm EST

https://assets.lifesitenews.com/images/made/images/remote/https_www.lifesitenews.com/images/local/Shutterstock/shutterstock_1739345507_810_500_75_s_c1.jpg

HURON, Ohio, January 27, 2021 (LifeSiteNews) — A 39-year-old woman with no known comorbidities died unexpectedly in northern Ohio within 48 hours of receiving a COVID-19 vaccine, which was reportedly required by her employer.

Janet L. Moore, a nurse aide at Admirals Pointe Nursing Home (APNH) in Huron, was found unresponsive in her car outside her apartment complex on December 31 around 8:00 p.m., her brother Jacob Gregory told LifeSiteNews.

“She was coming home from work and as soon as she drove into her parking lot she passed away,” he said. “According to her neighbors she wasn’t feeling good directly after the vaccine, and then ever since the vaccine she was actually feeling nauseated, she’d have like migraines and stuff like that. And then, within 48 hours, she ended up passing away.”

When asked if he knew the brand of the vaccine, Gregory, who lives in Akron, said, “According to my brother, it was by Pfizer, but I’m not absolutely sure on that.”

Gregory mentioned that his deceased sister, a mother of two sons, was required to receive this vaccine due to her nursing home employment.

“Yes, it was a mandatory vaccine that she had to take for her job,” he said.

When asked if it was a condition for her employment, he answered, “As far as that extent, I’m not sure how much pressure they are actually pushing. They did tell her that she needs it for her job, but I’m not exactly sure if they were going to lay her off, or fire her, or to what extent it would actually take.”

Trisha Brown, Administrator at APNH, declined to comment on whether it was the policy of their organization to require the vaccine, if Moore actually received such an injection, or whether they were administering a Pfizer or Moderna product.

A nursing home in Janesville, Wisconsin, which mandated their employees receive these experimental biological agents did in fact lay off workers who declined the injections.

Nearly a dozen employees were forced from their jobs due to the policy, and 27 wrote letters of complaint seeking to have the policy changed.

Their concerns included how this biological agent, which was rushed through development and testing, may have dangerous, unknown long-term effects, while others expressed worries about it affecting their pregnancy or fertility.

More generally they objected to being told they had to take a vaccine which was not approved by the Food and Drug Administration (FDA). While these vaccines have been given emergency use authorization by the FDA, neither has the full approval of the agency.

Estimates from the American Health Care Association suggest that around 50 percent of long-term care staff are declining the injections.

The U.K. government issued a 10-page report late last year that warned coronavirus vaccines should not be used by pregnant or breastfeeding mothers. With regard to their impact on fertility, the document simply states it is “unknown whether COVID-19 mRNA Vaccine BNT162b2 has an impact on fertility.”

Safety concerns with these vaccines also include “allergic” and “potentially fatal reactions,” that they may actually cause an increased vulnerability to the virus, and that, indeed, worries over long-term effects remain legitimate as these vaccines lack proper testing.

In addition, the FDA also drew up a document this fall listing the possible side-effects from a COVID-19 vaccine, including strokes, encephalitis, auto-immune disease, birth defects, Kawasaki disease, and death.

Dachsie
29th January 2021, 06:23 PM
Tim Zook had to work with COVID patients, and posted this selfie in full gear, urging people to be safe.

This photo of Rochelle and Tim Zook was Zook’s Facebook profile picture.


https://www.ocregister.com/2021/01/26/health-care-worker-dies-after-second-dose-of-covid-vaccine-investigations-underway/?fbclid=IwAR2Dwp6_imUtvBRiI3RGBFyTGMP75hieQ5OHARhJ s9hKEc6PWluTQET5GLI

Health care worker dies after second dose of COVID vaccine, investigations underway
‘The message is, be safe, take the vaccine — but the officials need to do more research. We need to know the cause,’ said the wife of Tim Zook of Orange

https://www.ocregister.com/wp-content/uploads/2021/01/OCR-L-VIRUS-VACCINEDEATH-0127-04-MS-1.jpg?w=832

Rochelle Zook holds her husband Tim’s favorite family photo. Zook, 60, died after receiving his second dose of the COVID-19 vaccine. He was an X-ray technologist at South Coast Global Medical Center in Santa Ana. (Photo by Mindy Schauer, Orange County Register/SCNG)
By Teri Sforza | tsforza@scng.com | Orange County Register
PUBLISHED: January 26, 2021 at 4:44 p.m. | UPDATED: January 28, 2021 at 7:58 a.m.

Tim Zook’s last post on Facebook brimmed with optimism. “Never been so excited to get a shot before,” he wrote on Jan. 5, above a photo of the Band-Aid on his arm and his COVID-19 vaccination card. “I am now fully vaccinated after receiving my 2nd Pfizer dose.”

Zook, 60, was an X-ray technologist at South Coast Global Medical Center in Santa Ana. A couple of hours later, he had an upset stomach and trouble breathing. By 3:30 p.m. it was so bad his colleagues at work walked him to the emergency room. “Should I be worried?” his wife, Rochelle, texted when she got the news. “No, absolutely not,” he texted back. “Do you think this is a direct result of the vaccine?” she typed. “No, no,” he said. “I’m not sure what. But don’t worry.”

There were suspicions of COVID and a diagnosis of congestive heart failure. Zook was put on oxygen, then — just four hours later — a BiPAP machine to help push air into the lungs. Multiple tests came back negative for COVID.

https://www.ocregister.com/wp-content/uploads/2021/01/OCR-L-VIRUS-VACCINEDEATH-0127-03-MS-1.jpg?w=620

Rochelle Zook with her sons Jared, left, and Kyle, hold a memory blanket given to her after her husband Tim’s death. Zook died after receiving his second dose of the COVID-19 vaccine. (Photo by Mindy Schauer, Orange County Register/SCNG)
Shortly after midnight on Jan. 7, the hospital called. Zook was in a medically induced coma and on a ventilator to help him breathe. But his blood pressure soon dropped and he was transferred to UC Irvine Medical Center. “On Friday I get a call, ‘His kidneys are failing. He needs to be on dialysis. If not, he could die — but there’s also a chance he might have a heart attack or stroke on dialysis because his blood pressure is so low,’ ” Rochelle Zook said.

By 4 a.m. Saturday, Jan. 9, Zook had gone “code blue” twice and was snatched back from the brink of death. There was a third code blue in the afternoon. “They said if he went code blue a fourth time, he’d have brain damage and be a vegetable if he survives,” Rochelle Zook said.

Later that day, Tim Zook died.
Reaction? But no blame

“We are not blaming any pharmaceutical company,” said Rochelle Zook, a resident of Orange. “My husband loved what he did. He worked in hospitals for 36 1/2 years. He believed in vaccines. I’m sure he would take that vaccine again, and he’d want the public to take it.

“But when someone gets symptoms 2 1/2 hours after a vaccine, that’s a reaction. What else could have happened? We would like the public to know what happened to Tim, so he didn’t die in vain. Severe reactions are rare. In reality, COVID is a much more deadly force than reactions from the potential vaccine itself.

“The message is, be safe, take the vaccine — but the officials need to do more research. We need to know the cause. The vaccines need to be as safe as possible. Every life matters.”

Zook had high blood pressure, but that had been controlled with medication for years, she said. He was slightly overweight, but quite healthy. “He had never been hospitalized. He’d get a cold and be over it two days later. The flu, and be over it three days later,” she said.

His death has been reported to the national Vaccine Adverse Event Reporting System, run by the Food and Drug Administration and Centers for Disease Control. The Orange County coroner has said the cause of death is inconclusive for now, and further toxicology testing will take months.

“The family just wants closure,” said Zook’s cousin, Ken Polanco of Los Angeles. ” ‘Inconclusive’ is not closure. The family wants the pharmaceutical companies to do more research — if there’s some sort of DNA that doesn’t work with this vaccine, if episodes like this can be prevented, they need to do what they can to pin that down.”
Other deaths post-vaccine

Zook’s death comes on the heels of a Florida doctor who died on Jan. 3, weeks after getting his first Pfizer shot. Gregory Michael, a 56-year-old obstetrician and gynecologist in Miami Beach, suffered idiopathic thrombocytopenic purpura (ITP), a rare immune disorder in which the blood doesn’t clot normally. His death is under investigation.

In California, Placer County officials said a man died shortly after receiving a COVID-19 vaccine on Jan. 21. They did not identify the vaccine or the person, but said he had tested positive for COVID in late December and that the vaccine was not given by the Placer County Public Health Department. Facebook posts say the man was a 56-year-old aide in a senior living facility. That death is under investigation as well.

The Vaccine Adverse Event Reporting System — which officials caution is a “passive surveillance system” and represents unverified reports of health events that occur after vaccination — has gathered more than 130 reports of death after vaccine administration thus far in 2021. A total of 1,330 adverse reactions have been reported, while more than 23.5 million doses of the Pfizer and Moderna vaccines have been administered.

Experts caution that drawing a causal line between vaccination and death is often very difficult to do. When millions of people are being vaccinated — more than 13 million have gotten the Pfizer vaccine as of Jan. 26, and more than 10.5 million have received the Moderna vaccine — some would die for any number of unrelated reasons, as a matter of pure statistics.

Every year in the United States, more than 2.8 million people die. That averages out to more than 7,800 deaths per day, according to CDC data.

“No prescription drug or biological product, such as a vaccine, is completely free from side effects. Vaccines protect many people from dangerous illnesses, but vaccines, like drugs, can cause side effects, a small percentage of which may be serious,” says the Department of Health and Human Services in its primer on the VAERS data. “About 85-90% of vaccine adverse event reports concern relatively minor events, such as fevers or redness and swelling at the injection site. The remaining reports (less than 15%) describe serious events, such as hospitalizations, life-threatening illnesses, or deaths. The reports of serious events are of greatest concern and receive the most careful scrutiny by VAERS staff.

“It is important to note that for any reported event, no cause and effect relationship has been established. The event may have been related to an underlying disease or condition, to medications being taken concurrently, or may have occurred by chance.”

Pfizer-BioNTech probe

A spokesman for Pfizer-BioNTech said the company is aware of Zook’s death and is thoroughly reviewing the matter.

“Our immediate thoughts are with the bereaved family,” the company said in an emailed statement. “We closely monitor all such events and collect relevant information to share with global regulatory authorities. Based on ongoing safety reviews performed by Pfizer, BioNTech and health authorities, (the vaccine) retains a positive benefit-risk profile for the prevention of COVID-19 infections. Serious adverse events, including deaths that are unrelated to the vaccine, are unfortunately likely to occur at a similar rate as they would in the general population.”

The Orange County Coroner has an open death investigation into Zook’s death and will be conducting additional tests within its autopsy protocol, spokeswoman Carrie Braun said. It will use those findings, along with autopsy findings, to make a final determination into the cause and manner of death. “If it’s determined there may be a correlation to the vaccine, we will immediately notify the OC Health Care Agency,” she said.

The FDA said it takes all reports of adverse events related to vaccines seriously, and, along with CDC, “is actively engaged in safety surveillance” of the COVID-19 vaccines that are being administered under emergency use authorizations.

“Any reports of death following the administration of vaccines are promptly and rigorously investigated jointly by FDA and CDC,” it said in an emailed statement. “Such an investigation includes working with health care providers to obtain medical histories and clinical follow-up information.”

Mark Ghaly, secretary of health and human services in California, said the state is looking into these incidents as well. He sends condolences to those who’ve lost loved ones, but stands by the scientific conclusion that the vaccines are safe.

“The details are complex and worthy of further investigation, and that’s what we’re doing now,” Ghaly said on Monday, Jan. 25, on the heels of the Placer death. “Overwhelmingly, though, we’ve seen so many individuals successfully, and without any significant reactions, receive both the Moderna and Pfizer vaccines.”

Results of the state’s probes will be shared publicly, Ghaly said, along with “lessons learned.” That’s key to continuing the development of confidence in the vaccines “and getting us on the other side of this pandemic,” he said.
This photo of Rochelle and Tim Zook was Zook’s Facebook profile picture.
Caring, generous man

Zook was a man who passionately urged folks to embrace COVID precautions such as masking up and staying home as ICUs were inundated in December. He loved food, posting photos of home-grown zucchinis, thick steaks, sumptuous Sunday breakfasts, wine tasting in Sonoma.

He shared memes urging calm on Election Day, quoting Lincoln saying “We are not enemies, but friends,” and was moved to share the speech President John F. Kennedy never got to deliver: “Let us not quarrel amongst ourselves when our Nation’s future is at stake. Let us stand together with renewed confidence in our cause — united in our heritage of the past and our hopes for the future — and determined that this land we love shall lead all mankind into new frontiers of peace and abundance.”

Zook was a caring, generous man with deep love for his family, an always-open door and a gift for making others feel comfortable and welcome, friends and family say. Sympathies for his passing have poured in.

“Our deepest condolences are with Tim Zook’s family and loved ones,” said Matt Whaley, CEO of South Coast Global Medical Center, by email. “Tim was a part of our family, too, and we are all grieving his loss.”

Zook and his wife have three grown sons — Aaron, 30, Jared, 26, and Kyle, 24. Zook took a day off work on Monday, Jan. 4 — his last healthy day — to spend with Kyle, who’s fascinated by trains. They went train-spotting.

“They had the most beautiful day together,” Rochelle Zook said.

https://i0.wp.com/scng-dash.digitalfirstmedia.com/wp-content/uploads/2021/01/zook-covid-uniform.jpg?fit=620%2C9999px&ssl=1

Tim Zook had to work with COVID patients, and posted this selfie in full gear, urging people to be safe.

Dachsie
29th January 2021, 06:27 PM
https://www.bitchute.com/video/yGR6wnvKaGpM/?fbclid=IwAR1lHQ_bnhWn03EJCbuYKp08OBIm7f8r8yno0MQ7 RrR0wZtQZf-yWeERaDQ

Dr. Carrie Madej explains the 3 major components of the Moderna Vaccine (https://www.bitchute.com/video/yGR6wnvKaGpM/)

21:15 video runtime

https://static-3.bitchute.com/live/cover_images/W3zur1B3PqmK/XRdSP6MOtNwA0Bkq5tK2MqVi_640x360.jpg

First published at 21:13 UTC on August 25th, 2020.

channel image

SmithLovesTruth

SmithLovesTruth

122 subscribers

Dr. Carrie Madej explains the 3 major components of the Moderna Vaccine and the implications. This is a must view video. If this video doesn't open the eyes of those who don't get it, nothing will!

The orginal source for this video is: https://www.youtube.com/watch?v=ywuCRVJVDqs
Resource links are below:

Dachsie
29th January 2021, 06:31 PM
https://twitter.com/TruNews/status/1355268368736133120

TruNews™
@TruNews
MUST WATCH - Viral video by TikTok user showing warehouse full of body bags.

What they preparing for?

#depopulation #covidvaccine #cadaverbag

Tweet
See new Tweets
Conversation
TruNews™
@TruNews
MUST WATCH - Viral video by TikTok user showing warehouse full of body bags.

What they preparing for?

#depopulation #covidvaccine #cadaverbag
0:36
1.3K views
3:35 PM · Jan 29, 2021·Twitter Web App

embedded video of cases and cases of body bags in a warehouse.

This is TruNews Rick Wiles video shows weekdays at TruNews.com

Dachsie
29th January 2021, 06:33 PM
http://www.hackettstownlife.com/forum/945154

This is a simple website where people can share their experience in getting the vacine.

Dachsie
29th January 2021, 07:29 PM
https://static-3.bitchute.com/live/cover_images/Rbtrop3rRlZl/dfTWcTHA0jLU_640x360.jpg

https://www.bitchute.com/video/dfTWcTHA0jLU/

Tom Cowan and Andrew Kaufman - Why a CV19 Virus HAS NOT been Proven

Tom Cowan and Andrew Kaufman - Why a CV19 Virus HAS NOT been Proven (https://www.bitchute.com/video/dfTWcTHA0jLU/)

47:17 video runtime

First published at 00:48 UTC on January 30th, 2021.

channel image

Jim Fetzer

Jim Fetzer

3723 subscribers

Possibly the two most brilliant doctors who are taking apart the pervasive societal myth of viral contagion explain clearly why it's wrong.
Category News & Politics
Sensitivity Normal - Content that is suitable for ages 16 and over

Dachsie
30th January 2021, 11:19 AM
https://1.bp.blogspot.com/-U-SwGpcWzLg/YBUWzfKRSbI/AAAAAAAESRw/_ktnWdzPlCkTbJ69E1Y2SVjo5NSgcfZ2wCNcBGAsYHQ/w640-h640/klausswab.jpg

Dachsie
31st January 2021, 05:30 AM
Austria is rightly protesting this communist attack on the people to seize their livelihood.



https://www.youtube.com/watch?v=8fz-L-XL4oM


https://www.youtube.com/watch?v=8fz-L-XL4oM

LIVE: COVID sceptics hold protest in Vienna despite ban
2,625 watching now
•Started streaming 22 minutes ago
Like
Dislike
Share
Save
Ruptly
1.71M subscribers
Demonstrators are taking to the streets of Vienna on Sunday, January 31, to protest against government measures to curb the spread of COVID-19 despite a ban.

Austria's third strict coronavirus lockdown, which includes the closure of all non-essential businesses and a restriction on movement, was recently extended until February 7.

The country, which has a population of 8.9 million, has reported approximately 7,500 deaths with COVID-19 since the outbreak of the pandemic.

Dachsie
31st January 2021, 07:07 AM
How do they lie to thee? Let us count the ways.


___________________________

https://www.cdc.gov/coronavirus/2019-ncov/vaccines/different-vaccines/mrna.html




Understanding mRNA COVID-19 Vaccines

Understanding mRNA COVID-19 Vaccines (https://www.cdc.gov/coronavirus/2019-ncov/vaccines/different-vaccines/mrna.html)

Updated Dec. 18, 2020
Print

Messenger RNA vaccines—also called mRNA vaccines—are some of the first COVID-19 vaccines authorized for use in the United States.
New Approach to Vaccines

mRNA vaccines are a new type of vaccine to protect against infectious diseases. To trigger an immune response, many vaccines put a weakened or inactivated germ into our bodies. Not mRNA vaccines. Instead, they teach our cells how to make a protein—or even just a piece of a protein—that triggers an immune response inside our bodies. That immune response, which produces antibodies, is what protects us from getting infected if the real virus enters our bodies.
A Closer Look at How COVID-19 mRNA Vaccines Work

COVID-19 mRNA vaccines give instructions for our cells to make a harmless piece of what is called the “spike protein.” The spike protein is found on the surface of the virus that causes COVID-19.

COVID-19 mRNA vaccines are given in the upper arm muscle. Once the instructions (mRNA) are inside the immune cells, the cells use them to make the protein piece. After the protein piece is made, the cell breaks down the instructions and gets rid of them.

Next, the cell displays the protein piece on its surface. Our immune systems recognize that the protein doesn’t belong there and begin building an immune response and making antibodies, like what happens in natural infection against COVID-19.

At the end of the process, our bodies have learned how to protect against future infection. The benefit of mRNA vaccines, like all vaccines, is those vaccinated gain this protection without ever having to risk the serious consequences of getting sick with COVID-19.

COVID-19 mRNA Vaccines Will Be Rigorously Evaluated for Safety

mRNA vaccines have been held to the same rigorous safety and effectiveness standards [332 KB, 24 pages]external icon as all other types of vaccines in the United States. The only COVID-19 vaccines the Food and Drug Administration (FDA) will make available for use in the United States (by approval or emergency use authorization) are those that meet these standards.
mRNA Vaccines Are New, But Not Unknown

Researchers have been studying and working with mRNA vaccines for decades. Interest has grown in these vaccines because they can be developed in a laboratory using readily available materials. This means the process can be standardized and scaled up, making vaccine development faster than traditional methods of making vaccines.

mRNA vaccines have been studied before for flu, Zika, rabies, and cytomegalovirus (CMV). As soon as the necessary information about the virus that causes COVID-19 was available, scientists began designing the mRNA instructions for cells to build the unique spike protein into an mRNA vaccine.

Future mRNA vaccine technology may allow for one vaccine to provide protection for multiple diseases, thus decreasing the number of shots needed for protection against common vaccine-preventable diseases.

Beyond vaccines, cancer research has used mRNA to trigger the immune system to target specific cancer cells.

Related Links

FDA’s Vaccine Development 101external icon
FDA’s Emergency Use Authorization for Vaccines Explainedexternal icon
FDA Infographic: The Path for a COVID-19 Vaccine from Research to Emergency Use Authorization [724 KB, 1 page]external icon





Facts about COVID-19 mRNA Vaccines

They cannot give someone COVID-19.

mRNA vaccines do not use the live virus that causes COVID-19.

They do not affect or interact with our DNA in any way.

mRNA never enters the nucleus of the cell, which is where our DNA (genetic material) is kept.
The cell breaks down and gets rid of the mRNA soon after it is finished using the instructions.

Dachsie
31st January 2021, 08:32 AM
Credible Exposé

https://www.youtube.com/watch?v=8VFngRmp1HE

23:00 video runtime

Dale Bigtree

Erin Olszewski, RN

Covid Nurse at Elmhurst hospital , New York Hospital

DNR is medical terminology for Do Not Resuscitate



https://www.youtube.com/watch?v=8VFngRmp1HE

Covid 19 fraud exposed in NY Hospital
2,523,768 views
•Jun 13, 2020
73K
3.5K
Share
Save
Rune Fardal
26.9K subscribers
People with breathing problems due to anxiety are registered as Covid-19 patients.

"They are literally creating the pandemic that way."

Dachsie
31st January 2021, 08:02 PM
CDC & NFL Covid Study | Debbie Discusses 1.28.21
AmericaCanWeTalk Published January 28, 2021 47 Views

https://rumble.com/vdd91j-cdc-and-nfl-covid-study-debbie-discusses-1.28.21.html

6:43 video runtime

https://rumble.com/vdd91j-cdc-and-nfl-covid-study-debbie-discusses-1.28.21.html

__________________________________________________ _______________________


https://www.americanthinker.com/articles/2021/01/cdcnfl_publish_revealing_wuhan_virus_paper.html

https://www.americanthinker.com/images/bucket/2021-01/226933_5_.png

January 28, 2021
CDC/NFL Publish Revealing Wuhan Virus Paper
By Trevor Thomas

Multiple outlets have recently reported on a new “scientific paper” published by the CDC in partnership with the NFL. The paper was authored by “medical experts” from both the NFL and the NFL Players Association. The paper details the efforts by the NFL to conduct its season in the midst of the Wuhan virus. As the lockdown narrative still prevails across much of the U.S., this paper provides some important revelations.

Before discussing the paper, it is important to note that, despite a few postponements and unlike the NCAA and thousands of high schools across the U.S. that caved to the Wuhan virus fear narrative, every NFL regular season game was played. Only the Super Bowl remains.

Reporting on the CDC/NFL paper, Fox News notes that “from Aug. 9 to Nov. 21 approximately 623,000 COVID-19 tests were performed on approximately 11,400 players and staff members and 329 tested positive (2.9%).” That’s about 55 tests per individual conducted over a 105-day period. (This period constitutes the bulk of the NFL regular season.) That means, on average, that NFL employees were getting tested once every two days.

The 2.9% number is calculated by dividing the number who tested positive (329) by the total number tested (11,400). However, it would be more revealing to note, of the 623,000 tests, how many tests were positive. Almost certainly this number is significantly lower than 2.9%. It’s also important to note that in spite of these “positive” tests, almost zero serious illnesses from the Wuhan virus were reported.

In other words, though the NFL’s rampant testing yielded a few “positives,” virtually no one got sick. Almost every player or coach who was reported to have missed a game had to do so because of a “positive test.” Thus, as we have seen throughout the past ten months, a “positive test” does not in any way indicate an actual Wuhan virus case.

Only two NFL employees -- Denver’s defensive coordinator Ed Donatell and Jacksonville running back Ryquell Armstead -- reportedly had to be hospitalized due to Wuhan virus complications. Both have fully recovered. It seems that for NFL players -- and for football players at any level -- the dangers from the Wuhan virus pale in comparison to the dangers that come from playing in football games.

Most telling from the CDC/NFL paper was the fact that, according to Dr. Allen Sills, the NFL’s chief medical officer, “We have not seen any evidence of on-field transmission in NFL games or practices.” Dr. Sills added,

I think that that is an important observation. It’s certainly a question that many people raised before we started as to why that occurred. I think there are a number of theories that people have advanced. One of them is that obviously we’re playing either in an open area or at least an extremely large air environment where we’ve got a lot of ventilation, a lot of movement and likely quick dispersal of any droplets or particles.

So in over 256 NFL games (not including playoff games), and for well over 1,000 practices (probably closer to 2,000) involving 32 teams and over 2,000 players, there was zero evidence of “on-field transmission.” This is significant because of what happens during an NFL game or practice.

Football is akin to ritualized combat. Every play involves multiple boys or men engaged in blocking, tackling, pushing, pulling, and so on. What’s more, because this is done over a multiple-hour period while running in full (or, in the case of practice, sometimes partial) pads, this variety of numerous close contacts is done while players are profusely expelling bodily fluids via sweating, spitting, bleeding, and the like.

So after thousands of hours involving hundreds of thousands of extremely close, maskless contacts in which bodily fluids were almost always present, the NFL and the CDC are telling us that there were zero person-to-person transmissions of the Wuhan virus! Don’t tell me this had anything to do with the fact that some players wear face shields (many, if not most, did not -- they were not required). In fact, the CDC does not recommend face shields to prevent the spread of the Wuhan virus.

If, as Dr. Sills suggests, this lack of transmission is due to the fact that NFL games and practices are conducted “in an open area or at least an extremely large air environment where we’ve got a lot of ventilation,” then why in the world would any government official or municipality mandate masks, etc. for outdoor activity?! In fact, given that many NFL games and practices are in large indoor facilities -- and given that there was zero person-to-person transmission where rampant close contact was present -- why would any mall, church, school, or Walmart, mandate masks?

Why did the NFL mandate masks on its sidelines? If sweaty, bleeding players engaged in hand-to-hand battles did not spread the virus, why in the world would merely standing on a sideline be any more dangerous?

This data from the NFL should again make it clear that, for the young and healthy, the Wuhan virus presents little to no danger. Along with the fact that a mountain of other data has shown that masks and mask mandates do not prevent the spread of the Wuhan virus, this data from the NFL should also put an end to the widespread masking of Americans. This is especially true for the young and any who are asymptomatic.

Trevor Grant Thomas
At the Intersection of Politics, Science, Faith and Reason.
www.TrevorGrantThomas.com
Trevor is the author of The Miracle and Magnificence of America
tthomas@TrevorGrantThomas.com

Image: NFL

Dachsie
1st February 2021, 11:13 AM
https://www.churchmilitant.com/news/article/council-of-europe-prohibits-mandatory-vaccination

churchmilitant.com

https://www.churchmilitant.com/images/uploads/news_feature/Screenshot_2021-01-30_at_11.09.04.png


Council of Europe Bans Forced Vaccination
(https://www.churchmilitant.com/news/article/council-of-europe-prohibits-mandatory-vaccination)



You are not signed in as a Premium user; we rely on Premium users to support our news reporting. Sign in or Sign up today!

STRASBOURG, France (ChurchMilitant.com) - In a knockout blow to European countries and globalist influencers considering forced vaccinations of citizens, the Council of Europe (CoE) passed a decree Wednesday prohibiting compulsory COVID-19 vaccinations.
Image
Protestors are fighting against a new 'vaccine apartheid'

Resolution 2361 (2021) orders governments to ensure "that citizens are informed that the vaccination is NOT mandatory and that no one is politically, socially, or otherwise pressured to get themselves vaccinated, if they do not wish to do so themselves."

The CoE, which is the European Union's leading human rights organization and the governing body of the European Court of Human Rights, also instructed member states to "ensure that no one is discriminated against for not having been vaccinated, due to possible health risks or not wanting to be vaccinated."

With respect to COVID-19 vaccination for children, the CoE demanded "that the wishes of children are duly taken into account in accordance with their age and maturity."

"Where a child's consent cannot be given," authorities should "ensure that agreement is provided in other forms and that it is based on reliable and age-appropriate information," the resolution states.
Vatican's Rules Defy Human Rights

The Vatican risks falling foul of the decree as it discriminates against Catholic journalists who are unwilling to be vaccinated on grounds of conscientious objections to taking the abortion-tainted COVID-19 jab or against reporters who are reluctant to be vaccinated fearing the side-effects of the experimental jab.

https://www.churchmilitant.com/images/uploads/news_feature/tony.jpg
Globalist vaccine zealot Tony Blair calls for a vaccine passport


The Holy See Press Office has made it mandatory for reporters accompanying Pope Francis on his March trip to Iraq to be vaccinated.

"In order to participate in the Apostolic Journey of the Holy Father Francis in Iraq, it is necessary to have undergone the vaccination against COVID-19 within the appropriate time," the Vatican, which has observer status at the CoE, announced.

There is absolutely no need for vaccines to extinguish the pandemic. You do not vaccinate people who aren't at risk from the disease.Tweet

Even if journalists are vaccinated, they may "receive a positive result in the prescribed PCR tests before departure from Rome" and so "will not be able to participate in the trip and will have to bear the costs of the penalties for the hotel in Iraq and the air ticket," the press office stated.
Pfizer Ex-VP: 'Frightening' Push

Dr. Michael Yeadon, former vice president and chief scientist of Pfizer pharmaceuticals, said it is "frightening that [such] a resolution is needed."

Criticizing the gung-ho approach of the British government's Scientific Advisory Group for Emergencies (SAGE), Yeadon wrote: "There is absolutely no need for vaccines to extinguish the pandemic. You do not vaccinate people who aren't at risk from the disease."

Scientist Dr. Michael Yeadon warning against the COVID-19 vaccine


Yeadon warned against "planning to vaccinate millions of fit and healthy people with a vaccine that hasn't been extensively tested on human subjects."

The resolution will be a challenge to countries considering the introduction of "immunity passports" resulting in a "vaccine apartheid."
Apartheid Proponents

Britain's The Telegraph, a formerly conservative newspaper, has insisted on legislation enshrining a "no jab, no job" policy.

If people don't want the vaccine, let them sit at home and not have a normal life.Tweet

"Parliament should legislate for no jab, no job this week — and that way everyone will know where they stand and can start planning for the future," the column stated Thursday.
Image
Globalist vaccine zealot Tony Blair calls for a vaccine passport

"Parliament should pass a one-line bill this week making it clear that it is legal to discriminate on the grounds of whether a person has been vaccinated against COVID-19, and that no claims on the grounds of unfair dismissal will be accepted," columnist Matthew Lynn demanded.

The controversy over compulsory jabs erupted in Britain after Pimlico Plumbers chairman Charlie Mullins said the company would rewrite all of its workers' contracts forcing them to be vaccinated against coronavirus.

"If people don't want the vaccine, let them sit at home and not have a normal life," Mullins said, noting at the same time the firm was "not putting anyone under any pressure" to have the shot.

But employment lawyers warned that companies could not force employees to be vaccinated.

Thrive Law managing director Jodie Hill told the BBC: "Even if they put that [requirement] in a new contract, I don't think they'd get away with it."
Global COVID Pass?

The Tony Blair Institute for Global Change, an initiative of former U.K. prime minister Tony Blair, called on the government to "take the lead on developing a single, global COVID Pass."

Blair, a convert to Catholicism, said the digital passport should include COVID-19 test results, details of vaccinations and be capable of tracking and verifying a person's coronavirus "status" wherever they travel in the world.

The CoE has 47 member states but also maintains close links with numerous non-member states, five of which have observer status with the organization: the Holy See (1970), the United States of America, Canada and Japan (1996) and Mexico (1999).

A state may be granted observer status if it is willing to accept the principles of democracy; the rule of law; and the enjoyment by all persons within its jurisdiction of human rights and fundamental freedoms; and if it is willing to cooperate with the CoE.

The mainstream media, which has been pushing a pro-vaccine narrative in conjunction with governments, has avoided reporting on the resolution.

Dachsie
1st February 2021, 12:49 PM
I wonder how much Dr. Krenn was paid for this propaganda performance recommending the Moderna vaccine stating the side effects, though significant, are much lighter than having "Covid-19".

This semi-sophisticated propaganda is wrong on every level.

Caveat Emptor

https://www.youtube.com/watch?v=BAZEoMMnNoM


https://www.youtube.com/watch?v=BAZEoMMnNoM

8:13 video runtime

Second COVID-19 Vaccine Side Effects - Rougher Than I Expected
92,081 views
•Jan 25, 2021
1.5K
222
Share
Save
Louis Krenn MD
1.07K subscribers
The expected side effects of the second dose of COVID-19 vaccine have been well publicized. I think I experienced everyone of them! For about 36hrs after my second dose I went through what I can only imagine what a mild to moderate case of COVID must be like. However, my side effects lasted much shorter than the real thing and I will not have any long lasting consequences that COVID itself can bring. I share my story to encourage everyone to get the vaccine. You may be miserable for a day or so, but it is much better than getting the real thing! The side effects are expected, manageable, and short lived. Worth every minute to not get COVID! I highly encourage you to get the vaccine when it's your turn.

https://www.cdc.gov/coronavirus/2019-...

------------------------------------
WEBSITE: https://www.louiskrennmd.com
FACEBOOK: https://www.facebook.com/LouisKrennMD/
INSTAGRAM: https://instagram.com/LouisKrennMD
TWITTER: https://twitter.com/LouisKrennMD

This video is for educational purposes only. It is not intended to diagnose or treat any condition in any way. Always consult a medical professional for matters concerning your personal health.

Dachsie
1st February 2021, 02:25 PM
https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-february-01-2021 (https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-february-01-2021)

Daily Corona news with TruNews Kerry Kinsey

TruNews Headlines with Kerry Kinsey - February 01, 2021

David Knight says nursing home deaths are surging after Covid vaccinations. Dr. Lee Merrit says all animals died in trials that were done with similar vaccines.

A priest, from Rome, claims this whole Covid plandemic is satanic. He also says one of their goals is to make sure you suffocate yourself wearing a diaper on your face.

On ‘Corona Crazy,’ Glenn Beck takes Fauci’s double-masking advice and then some; he tries out ten masks, and CBS News says China is pushing to control America’s healthcare future.
Content Contributed By — TruNews Team

monty
1st February 2021, 04:29 PM
I always suspected the nose swabs were for DNA collection but didn’t realize China wanted our DNA

https://www.technocracy.news/claim-china-tried-to-collect-us-dna-samples-from-nose-swabs/

Dachsie
1st February 2021, 07:51 PM
Biden's Vaccine Taskforce loses twenty million doses of the Covid vaccine and blames that on Trump.


https://s.yimg.com/ny/api/res/1.2/JH08dy6mYTzziDijJTuTUw--/YXBwaWQ9aGlnaGxhbmRlcjt3PTcwNTtoPTM5Ni40ODcxNzk0OD cxNzk1/https://s.yimg.com/uu/api/res/1.2/JRe3yuEQc2XEp4Imm70mbA--~B/aD02NTg7dz0xMTcwO2FwcGlkPXl0YWNoeW9u/https://media.zenfs.com/en/thedailybeast.com/825972913277b19690d143e9020dc5cd

Twenty Million Vaccine Doses Are M.I.A.—and Feds Aren’t Sure Why (https://news.yahoo.com/millions-vaccine-doses-m-feds-100525358.html)



Erin Banco
Updated January 25, 2021

Millions of doses of COVID-19 vaccine are likely lost in the complex system to distribute the shots, U.S. officials believe. And no one working on the federal response to the coronavirus is quite sure why.

Members of President Joe Biden’s coronavirus task force have spent their first days in office working overtime to find an answer to this puzzle. So far, one hasn’t emerged.

According to data from the Centers for Disease Control (CDC), 41.4 million doses have been handed out to the states. Only 21.8 million have been administered. Officials say they think there is a vaccine surplus, although how large of one is unclear. Bottom line: Doses should be flowing, they said But instead, states are complaining of vaccine shortages.

Task force members rechecked the numbers—local and federal data— this week to try to discover the cause. They looked at whether there was enough being manufactured to fill demand; where that vaccine had been shipped and who had received it; how much was still sitting waiting to be administered; and how many doses were still sitting in warehouses. They’ve still come up short, officials tell The Daily Beast, in part because the data sets they are working with are incomplete.

“What we are seeing now is incredible inefficiencies. You have cities canceling vaccination appointments while the data says they still haven’t administered a large portion of the vaccine that’s been shipped to them. That is the biggest problem,” said Dr. Craig Spencer, an emergency doctor at New York Presbyterian Hospital.

In the weeks leading up to the inauguration, officials working with Biden’s coronavirus transition task force assumed that the low vaccination rates were due in part to a lag in states reporting to the CDC. The actual vaccination rates were far higher than those reflected on the federal government’s dashboard, the officials believed. They also calculated that some states were struggling to administer the vaccine efficiently because of staff shortages and, in some regions, because of a hesitancy among residents to sign up for the shot. The idea was that as states began to work out the kinks in reporting and distribution, rates would rise and supply would eventually meet demand.

Officials say they still believe all of that to be true. But the picture is even more muddled, and more complex, than they thought.

According to two officials working on the administration’s vaccine effort, some state officials, including in those states reporting vaccine shortages, have determined there might be additional doses in their jurisdiction—outside of their second-dose reserves— that are unaccounted for. But those state officials do not know whether those doses are sitting in warehouses, freezers or in other distribution hubs, or whether they have been used but unreported. In other words, there could be perhaps millions of doses across the country missing in the distribution system, officials said. There could be a number of explanations to explain the discrepancies; some doses could have expired or been contaminated or otherwise destroyed, though those scenarios are rare.

In response to a question about the discrepancy between states reporting shortages and the CDC alluding to the fact that there is a glut in vaccine doses across the country, Dr. Anthony Fauci, Biden’s chief medical adviser, said in a press conference that it would be “disturbing” if doses were found “laying around.”

The underlying issue seems even more daunting and perhaps more difficult to remedy, according to those same two Biden officials and two other individuals who worked with the Biden transition. There are massive inefficiencies on the city, county, state, and federal levels. There isn’t just one—or two or three or four—problems with the vaccine distribution process, officials said; there are dozens. And finding solutions to those problems will require a level of communication and coordination between the federal government and states that hasn’t existed since the pandemic hit.

Some cities lack comprehensive reporting systems to track where vaccines are located, whether there is adequate freezer storage, and whether doses are expiring on the shelf. And some states are having difficulty ensuring each distribution hub has enough vaccine supply for the appointments scheduled, in part because major cities in that state have their own separate distribution plan and tracking processes. Finally, some doses are getting held up as shipping companies are confused about which packages go where.

Streamlining the distribution will take time, officials said. But the clock is ticking. Not only is there a political imperative—President Biden repeatedly laid out a goal of 100 million shots in the first 100 days—but the CDC has said that it expects a more contagious variant of COVID-19 to spread throughout the U.S. in the next several months. While health experts say the vaccine should work against that variant, the Biden administration wants to get as many Americans vaccinated as possible as a way to prevent another spike in COVID-related deaths this spring.

‘Worse Than We Imagined’: Team Trump Left Biden a COVID Nightmare

CDC Officials Urge Biden Team to Dump Palantir’s COVID Tracker

“There are real implications of this delay which is why we need to do this as quickly as possible. What I want to hear is that you’re willing to get every dose out and in someone’s arms. We can’t increase Pfizer or Moderna supply right now,” Spencer told The Daily Beast. “It’s going to take months.”

After more than a week of calling on the federal government to send additional vaccine doses, hospitals, doctors’ offices, and pharmacies across the country late last week sent out notifications alerting thousands of Americans that they would have to cancel first-dose COVID-19 vaccinations due to a lack of supply.

The U.S. vaccine rate is beginning to improve, but the mass cancellations prompted state leaders in states such as New York, New Jersey, Pennsylvania, Kentucky and California to speak out publicly about their shortages and the need for the federal government to do more to help. It was a familiar tone—one put to the Trump administration by governors who said they lacked testing and medical supplies and personal protective equipment needed to contain the spread of the virus.

“The supply that we’re going to get next week is already 30,000 doses underneath our ability of what we can put in someone’s arm in just a seven-day span,” Kentucky Gov. Andy Beshear said in a press conference Jan. 20. Kentucky has begun canceling some vaccine appointments due to the shortage. According to the CDC’s vaccine tracker, the state has received 471,000 vaccine doses but has only administered 299,493. According to data gathered by The Washington Post, the doses that Kentucky has administered has covered just 24.8 percent of the prioritized population.

Although governors across the country are dealing with increasingly frustrated and disheartened constituents, some of whom have had their vaccine appointments canceled over the last two weeks because of shortages, officials with the Biden COVID-19 task force say they’re not too concerned about the supply issue. At least not yet.

“It’s better to have the demand… to have vaccine sitting on shelves even if there are lines and queues, than to have people not wanting to sign up and take it,” one individual working on the administration’s vaccine effort said, adding that the Biden team expects supply and demand to swing back and forth over the coming months as the country recalibrates the distribution process.

Officials point to the decision made earlier this month to widen the pool of those who could receive the vaccine as a reason for the increase in demand for the shot. The Biden team and the outgoing Trump administration made the decision that they would recommend states allow individuals 65 and older and outside of the first wave of vaccine eligibility—people other than health-care, frontline workers and nursing home residents—receive the shot if they wanted. But officials say there was never a reserve of doses, even those the Trump administration said it had set aside as second-dose shots, to help states handle the increasing number of people signing up for vaccine appointments. In an interview with NBC’s Lester Holt Jan. 15 that the U.S. did not have a reserve stockpile.

States weren’t made aware of the reserve issue until it was too late—until they had scheduled hundreds of thousands of additional vaccine appointments.

Meanwhile, distribution hubs across the country were creating rules about who should and could get the vaccination and when on the fly. According to an individual who worked in one of New York City’s distribution hubs, volunteers did not ask for identification and sometimes forgot to ask for appointment confirmation. Volunteers at this particular hub rotated on a daily basis, this person said, and often received little instruction about how to run the distribution process. “We were just reinventing the wheel every day.”

Two individuals who spoke to The Daily Beast said they found a primary care health-care office in Jersey City, New Jersey where they could receive their first dose even though they were residents of New York.

In Fairfax, Virginia, a vaccine volunteer said his staff last week made the decision to hand out the shot to not only those who had made appointments but also anyone who accompanied those individuals to the distribution site.

It’s that lack of communication, and each state approaching the decision to vaccinate a wider pool of people differently, that has federal officials on edge. One senior health official said there was discussion in the Trump administration about the piecemeal vaccination distribution approach causing problems during the rollout. Those concerns were largely shot down, the official said, adding that states were rushed to submit their vaccination distribution reports and “barely had time to speak to the federal government about those plans before the vaccine shipped.”

“We knew this was coming,” the official said. “To some extent there was always going to be problems with a distribution campaign of this size and complexity. Things are bound to improve. But I’m not sure things had to get this bad.”

White House officials say they plan to hold a virtual meeting with the nation’s governors Tuesday to discuss vaccine distribution. But the federal government has no plans to increase vaccine supply at this time, officials said.

Over the next several weeks the Biden team plans to work closely with states to assess how many doses are already distributed that need to be accounted for, how many appointments have already been booked for first- and second-dose shots, and how many vaccine doses have been requested by states that have yet to be allocated. “Right now there’s no holistic way of accounting for all that,” one Biden official said.

Another official said there are discussions underway about the possibility of changing the way local health departments report their vaccination numbers to the federal government as a way to improve the administration’s understanding of the distribution effort.

In addition, the Federal Emergency Management Agency has established a new interagency vaccination task force in the agency’s National Response Coordination Center and is set to deploy staff to support dozens of vaccination sites across the country to help with distribution, according to a spokesperson for the agency.

In the meantime, Biden will tap the Defense Production Act to compel manufacturers to produce more personal protective equipment and to continue to scale testing across the country. Officials say Biden will also use the act and to develop more raw materials and syringes needed to increase vaccine production. Biden signed an executive order last week that allows federal agencies to “to fill those shortfalls as soon as practicable by acquiring additional stockpiles, improving distribution systems, building market capacity, or expanding the industrial base.”

Dachsie
1st February 2021, 09:12 PM
I always suspected the nose swabs were for DNA collection but didn’t realize China wanted our DNA

https://www.technocracy.news/claim-china-tried-to-collect-us-dna-samples-from-nose-swabs/

Yes, if China is trying to take over the USA and it is a Communist country, then this is just what a Communist country does.

What I find puzzling is that we are told China is taking over the USA and are deeply embedded/infiltrated into all USA societal institutions, but we are told the same thing about Israel, so logically, to me, China and Israel must be deeply affiliated and one of the two countries must totally control the other.

monty
1st February 2021, 10:33 PM
Yes, if China is trying to take over the USA and it is a Communist country, then this is just what a Communist country does.

What I find puzzling is that we are told China is taking over the USA and are deeply embedded/infiltrated into all USA societal institutions, but we are told the same thing about Israel, so logically, to me, China and Israel must be deeply affiliated and one of the two countries must totally control the other.

There is talk that Israel is abandoning its relationship here in favor of a relationship with China. They have bled our country now it's China's turn.

Dachsie
2nd February 2021, 07:21 AM
https://www.mostholyfamilymonastery.com/news/white-house-mask-mandate-implemented-on-public-transportation/#.YBld4XlMHIU

"White House mask mandate implemented on public transportation" - 1 minute video ("White House mask mandate implemented on public transportation" - 1 minute video)

an ABC News video

_______________

Good to see some Cfalifornia push-back on this truly killing fake vaccine program.


Here is YouTube link just for photo .


https://www.youtube.com/watch?v=WIjj8tgs3gs&feature=emb_logo


ABC News
10.9M subscribers
Starting Feb. 1, masks will now be a requirement on all rides, from planes to taxis, as COVID-19 cases continue to rise across the country.

Dachsie
2nd February 2021, 03:06 PM
https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-february-02-2021

12:09 video runtime

www.ICanDecide.org



________________________________

https://tributecenteronline.s3-accelerate.amazonaws.com/Obituaries/19522709/Thumbnail.jpg
https://www.lifesitenews.com/news/39-year-old-nurse-aide-dies-within-48-hours-of-receiving-mandated-covid-19-shot

HURON, Ohio, January 27, 2021 (LifeSiteNews) — A 39-year-old woman with no known comorbidities died unexpectedly in northern Ohio within 48 hours of receiving a COVID-19 vaccine, which was reportedly required by her employer.

Janet L. Moore, a nurse aide at Admirals Pointe Nursing Home (APNH) in Huron, was found unresponsive in her car outside her apartment complex on December 31 around 8:00 p.m., her brother Jacob Gregory told LifeSiteNews.

“She was coming home from work and as soon as she drove into her parking lot she passed away,” he said. “According to her neighbors she wasn’t feeling good directly after the vaccine, and then ever since the vaccine she was actually feeling nauseated, she’d have like migraines and stuff like that. And then, within 48 hours, she ended up passing away.”

When asked if he knew the brand of the vaccine, Gregory, who lives in Akron, said, “According to my brother, it was by Pfizer, but I’m not absolutely sure on that.”

Gregory mentioned that his deceased sister, a mother of two sons, was required to receive this vaccine due to her nursing home employment.
SUBSCRIBE to LifeSite's daily headlines
U.S. Canada World Catholic

“Yes, it was a mandatory vaccine that she had to take for her job,” he said.

When asked if it was a condition for her employment, he answered, “As far as that extent, I’m not sure how much pressure they are actually pushing. They did tell her that she needs it for her job, but I’m not exactly sure if they were going to lay her off, or fire her, or to what extent it would actually take.”

Trisha Brown, Administrator at APNH, declined to comment on whether it was the policy of their organization to require the vaccine, if Moore actually received such an injection, or whether they were administering a Pfizer or Moderna product.

A nursing home in Janesville, Wisconsin, which mandated their employees receive these experimental biological agents did in fact lay off workers who declined the injections.

Nearly a dozen employees were forced from their jobs due to the policy, and 27 wrote letters of complaint seeking to have the policy changed.

Their concerns included how this biological agent, which was rushed through development and testing, may have dangerous, unknown long-term effects, while others expressed worries about it affecting their pregnancy or fertility.

More generally they objected to being told they had to take a vaccine which was not approved by the Food and Drug Administration (FDA). While these vaccines have been given emergency use authorization by the FDA, neither has the full approval of the agency.

Estimates from the American Health Care Association suggest that around 50 percent of long-term care staff are declining the injections.

The U.K. government issued a 10-page report late last year that warned coronavirus vaccines should not be used by pregnant or breastfeeding mothers. With regard to their impact on fertility, the document simply states it is “unknown whether COVID-19 mRNA Vaccine BNT162b2 has an impact on fertility.”

Safety concerns with these vaccines also include “allergic” and “potentially fatal reactions,” that they may actually cause an increased vulnerability to the virus, and that, indeed, worries over long-term effects remain legitimate as these vaccines lack proper testing.

In addition, the FDA also drew up a document this fall listing the possible side-effects from a COVID-19 vaccine, including strokes, encephalitis, auto-immune disease, birth defects, Kawasaki disease, and death.
— Article continues below Petition —

__________________________

https://www.youtube.com/watch?v=3mPIomjWwd4


https://www.youtube.com/watch?v=3mPIomjWwd4

30:11 video runtime

Supplements for your "Covid Kit"

NAC
C
D
Zinc
Selenium
quercetin

_____________________

also hydroxychloroquine and ivermectin

___________________________



Dr Lee Merrit Interview
605,117 views
•Jan 16, 2021
12K
570
Share
Save
Peter Humphrey
5.21K subscribers

PatColo
2nd February 2021, 03:40 PM
kaminski:

A plan for you, brother! (https://www.johnkaminski.org/index.php/john-kaminski-american-writer-and-critic-2/304-a-plan-for-you-brother)

Published: Tuesday, 02 February 2021 11:50



Have you recognized what’s really going on?
The actual epidemic is Big Pharma’s
worldwide plan to cull the population


It’s easy to tell the fakes and the frauds from the genuinely puzzled. The first group has all the money in the world and a foolproof plan for the future while the rest of us follow along and scramble for the meager crumbs of their tasty treats while trying to avoid their slash-and-burn projects. The fakes and the frauds pretend to know what’s actually going on. If we’re lucky, we eventually learn to know that the stories they tell never can withstand re-examination.

And when we see what’s happening we are astonished that practically everyone could be so stupid as to fall for the most evil medical malpractice maneuver in the history of our species.

Worse than lobotomy, worse than circumcision, the COVID lockdowns have not only tainted the personalities of future generations with inexplicable fear, they have destroyed the world’s economy on the basis of the whims of rich of men who have decided once and for all to cull the herd and regiment artificially created and technologically augmented individuals exclusively pursuing patterns of activity installed prior to birth as chosen by their designers.

Everybody else is good as gone. Don’t bother packing your bags because there is nowhere you can go where they can’t find you.

We have only the painful evidence of their mismanagement of our world to guide our responses to this assault on our freedom and our lives, which we must do if our intention is to survive.


Either we stop the masks and lockdowns, or they stop us . . . permanently.


These are your choices: you can lay down and die, or you can fight back.

Here’s what I think is going on . . .

The thing to remember is this. The most powerful people in the world have embarked upon a venture to eliminate large numbers of people from the world, which they are now doing through many methods but especially through their Frankenstein vaccine, which turns healthy people into corpses sooner than the doctor can say, “See now, it wasn’t that bad, was it . . .”

Our better natures have been victimized by those who don’t have a better nature, but realize that appealing to the better nature of others is a sure way to get them to reveal the things that can be stolen from them. This has ruined the future because now, since their near-universal participation in the greatest medical hoax of all time, doctors can no longer be trusted to “first, do no harm.”

The new key to individual health is to stay away from mainstream doctors so they can’t find a way to kill you.

Soulless financiers have erased all traces of spiritual power in the world, mostly by buying religious leaders and top politicians with forbidden fruit available only to the very rich.

They are warping your mind by forcing you to believe the lies they tell you, such as germs cause disease, all elections are honest, and that there is strength in diversity.

Religions are not tools for your liberation, they condition you into becoming an obedient citizen. Today when you become an obedient citizen you are giving up your life, because our leaders have always been men who will say anything their masters tell them to say. They are also men who will kill those they are told to kill without any trace of a second thought.

This is the human race. This is what we formerly called our country. Now we search in vain for a rational description of the deliberately created insanity our country has become. In doing so we must first confront our own complicity in our burgeoning disaster.

Anyone with a conscience must ask themselves, how did we let this happen?

It’s too easy to say we were deceived, we were misled by clever Jewish media to accept the prizes they offered to cover up the carnage we have condoned in the world under the rubric of freedom and liberty, when the program was really economic exploitation and total psychological control.


We can’t go home again


We have verged so far away from actual reality we might not recognize it if we are lucky enough to return there.

Locked in our condo cells with masks on our faces we are urged to take an inoculation they say will make us safe to come out into the world, though it won’t protect us from any diseases, only from the government.

The vaccine turns your immune system against your own cells so that you will perish in agony, as so many have, all gifts from our Big Pharma world planners.


They have a plan for you, brother. And you’re not in it!


We have given government the power to make healthy people sick.

There is no longer any law enforcement, if there ever was. The cops are employed to protect the property of the banks, nothing else. Anybody who gets in the way was in the wrong place at the wrong time and nothing further need be said.

All of these events have rendered freedom inert, a moot proposition, a lost cause. You have the freedom to be completely innocent and still be killed by a cop.

You can’t win in court unless you have the approval of the powers that be. Those Jewish billionaires who collected all the insurance money from the 9/11 caper have every single judge on the federal bench in their pocket.

God help you if you need a doctor. It is the supreme irony of this perverse plandemic that idle doctors in empty clinics refused to see actually sick people because they were waiting to be deluged with COVID patients who, of course, never arrived. I know, Gov. Cuomo was killing seniors as fast as he could, but he still couldn’t — and they still can’t — produce the numbers or the deaths they need to convince everyone this is an epidemic. The only epidemic is people dying from the experimental and untested vaccines.

How can you trust a doctor that has signed on, hook, line and sinker, to the disgusting fabrication of the COVID vaccine, which is not a vaccine at all, but a device to actually change your DNA. Which, in the unlikely case you survive, you can never be changed back to the authentic human you used to be.


https://www.johnkaminski.org/index.php/john-kaminski-american-writer-and-critic-2/304-a-plan-for-you-brother

Dachsie
2nd February 2021, 04:17 PM
Entire show was about police state nature of "Covid" regulations.

https://www.trunews.com/stream/covid-anal-swabs-china-launches-new-propaganda-scare-campaign

COVID Anal Swabs: China Launches New Propaganda Scare Campaign
Content Contributed By — TruNews Team

Dachsie
2nd February 2021, 05:07 PM
[SIZE=4]http://www.radioliberty.com/pca.htm
[SIZE=6]
The Population Control Agenda part 1 of 2

Stanley K. Monteith, M.D.

One of the most difficult concepts for Americans to accept is that there are human beings dedicated to coercive population control and genocide. Many readers will acknowledge that our government is helping to finance the Red Chinese program of forced abortion, forced sterilization, infanticide, and control of the numbers of live births. Most readers will accept the fact that our nation is helping to finance the United Nations' world-wide "family planning program," a form of population control. Most rational men and women, however, find it impossible to believe that such programs are really part of a "master plan" to kill off large segments of the world's population.

I shall have to admit that I studied the politics of AIDS (HIV disease) for over a decade before I finally came to a horrifying conclusion. The real motivation behind efforts to block utilization of standard public health measures to control further spread of the HIV epidemic was "population control." That was not an easy concept for me to acknowledge, despite the fact that I had long recognized that the twentieth century has been the bloodiest hundred-year period in all recorded human history.

It was not until I journeyed to Elberton, Georgia, stood within the dark shadows of the great Druid-like monument built there, and read the words engraved on the massive stone pillars of that structure that I finally came to accept the truth. At that point it became obvious that just as our Lord has given mankind Ten Commandments to guide our lives, so, too, those from "the dark side" have been given their instructions from the "one" they worship. The ten programs of the "guides" are inscribed in eight different languages on the four great granite pillars of the American Stonehenge. That message foretells a terrifying future for humanity, and explains why efforts to approach the AIDS epidemic from a logical point of view have been consistently thwarted.1

Before you scoff, and reject my suggestion as some sort of madness, check out my references, then try to disprove my conclusions. If my allegations are unfounded, you will soon recognize the deception and return to your daily activities, certain that there is no cause for concern. On the other hand, should you determine that my assessment is correct, or even partially correct, then you have a moral obligation to decide just what part you intend to play in response to the unfolding world genocide - how you will protect yourself, your loved ones, and the countless millions of helpless human beings throughout the world who have been marked for destruction.

You must never forget the warning recorded for posterity by Martin Niemoeller, the Lutheran minister who lived in Hitler's Germany during the 1930s and 1940s. His words echo down to us over succeeding decades:

"In Germany they came first for the Communists, and I didn't speak up because I wasn't a Communist. Then they came for the Jews, and I didn't speak up because I wasn't a Jew. Then they came for the trade unionists, and I didn't speak up because I wasn't a trade unionist. Then they came for the Catholics, and I didn't speak up because I was a Protestant. Then they came for me, and by that time no one was left to speak up." 2

You will note that Reverend Niemoeller warned that after coming for the Jews the Nazis came for both Catholics and Protestants. Why is that fact never mentioned? The question that I am most frequently asked is, "How can you possibly believe that there are people who intend to kill off large segments of the world's population?" My answer is really quite simple. I hold that belief because I have read their writings. I believe they are telling the truth. Just as Adolf Hitler wrote of his plans for Europe in "Mein Kampf" (My Plan), so, too, those who intend to depopulate large segments of the earth have written of the necessity of limiting the world's population. They fully intend to "exterminate" a significant portion of the world's population. The fact that the vast majority of Americans have never heard of their intent, of The Georgia Guidestones in Elberton, or of "The Plan" and "The
Hierarchy" attests to the degree of control that exists over what the American people have been allowed to know about the occultic forces which are working within our society today.

Margaret Sanger and Planned Parenthood

As you read on you will soon discover that I have primarily relied on material which can be readily found in books, audio-taped interviews, and public news sources. If you take the time to check my references, you will soon discover that there really are those who have publicly advocated the elimination of "human weeds" and "the cleansing of society." Indeed, to this very day your tax money is used to finance Planned Parenthood, an organization founded by Margaret Sanger. During the 1930s Margaret Sanger openly supported the Nazi plan for genetic engineering of the German population, and the propagation of a "super race."

In Planned Parenthood's 1985 "Annual Report" leaders of that organization proclaimed that they were, "Proud of our past, and planning for our future." 3

How could anyone possibly claim to be proud of the organization founded by Margaret Sanger when history records that she wrote of the necessity of: "the extermination of 'human weeds' ...the 'cessation of charity,' ... the segregation of 'morons, misfits, and the maladjusted,' and ... the sterilization of 'genetically inferior races.'"4

Margaret Sanger published "The Birth Control Review." In that magazine she openly supported the "infanticide program" promoted by Nazi Germany in the 1930s, and publicly championed Adolf Hitler's goal of Aryan white supremacy. In the years prior to World War II Margaret Sanger commissioned Ernst Rudin, a member of the Nazi Party, and director of the dreaded German Medical Experimentation Programs, to serve as an advisor to her organization. In his excellent book "Killer Angel," George Grant chronicles the life and writings of Margaret Sanger, and painstakingly documents Sanger's plans for the genetic engineering of the human race. George Grant noted that in the 1920s Margaret Sanger wrote "The Pivot of Civilization" in which she called for:

"The 'elimination of 'human weeds,' for the 'cessation of charity' because it prolonged the lives of the unfit, for the segregation of 'morons, misfits, and the maladjusted,' and for the sterilization of genetically inferior races.'"5

According to George Grant, Margaret Sanger believed that the unfit should not be allowed to reproduce. Accordingly, she opened a birth control clinic in: "The Brownsville section of New York, an area populated by newly immigrated Slavs, Latins, Italians, and Jews. She targeted the 'unfit' for her crusade to 'save the planet.'" 6

Nineteen years later, in 1939, Margaret Sanger organized her "Negro project," a program designed to eliminate members of what she believed to be an "inferior race." Margaret Sanger justified her proposal because she believed that: "The masses of Negroes ...particularly in the South, still breed carelessly and disastrously, with the result that the increase among Negroes, even more than among whites, is from that portion of the population least intelligent and fit..." 7

Margaret Sanger then went on to reveal that she intended to hire three or four Colored Ministers "to travel to various black enclaves to propagandize for birth control." She wrote: "The most successful educational approach to the Negro is through a religious appeal. We do not want word to go out that we want to exterminate the Negro population, and the Minister is the man who can straighten out that idea if it ever occurs to any of their more rebellious members." (emphasis added-Ed.) 8

As Margaret Sanger's organization grew in power, influence, and acceptance, she began to write of the necessity of targeting religious groups for destruction as well, believing that the "dysgenic races" should include "Fundamentalists and Catholics" in addition to "blacks, Hispanics, (and) American Indians." 9

As the years went by, Margaret Sanger became increasingly obsessed with her occultic beliefs. Along with her acceptance of the occult, she became increasingly hostile to both Christianity and the American precepts of individual freedom under God. Her distaste for America can be seen in her writings when she wrote: "Birth control appeals to the advanced radical because it is calculated to undermine the authority of the Christian churches. I look forward to seeing humanity free someday of the tyranny of Christianity no less than Capitalism." 10 Margaret Sanger eventually embraced not only communism but theosophy as well. What is theosophy? It is a covert, occultic religion based upon the repudiation of God and the worship of Lucifer. In modern-day America, theosophy is one of the most powerful hidden (occult) forces working behind the scenes in New York City, Washington D.C., and across our nation today. 11

How many times have you been told that Adolf Hitler killed 6 million Jews in the Holocaust? What you probably have never been told, however, is the segment of the Holocaust tragedy recorded by Professor Norman Cohn in his historical account of the Jewish Holocaust, "Warrant for Genocide." Professor Cohn chronicled the dark days of World War II, noting: Only about a third of the civilians killed by the Nazis and their accomplices were Jews ...Other peoples were marked out for decimation, subjugation, and enslavement, and the civilian losses of some of these (countries - Ed.) amounted to 11 per cent to 12 per cent of the total population." 12

If Professor Cohn's figures are accurate - and I feel certain that they are, because other Jewish researchers have come up with similar figures - then why haven't the Christians of America been allowed to learn the fact that in addition to the 6 million Jews murdered by the Nazis, somewhere between 7 and 12 million non-Jews were also ruthlessly liquidated in Hitler's Germany?

I believe this information has been intentionally suppressed because those who were killed were largely Christians, and the covert forces which control the reality of the American public today do not want the followers of Jesus Christ in our nation to awaken to their peril ...until it is far too late. Hitler hated not only Jews and Judaism, he also hated Christians and Christianity as well. Why was that? Because Adolf Hitler, just like Margaret Sanger, was a disciple of theosophy and of Madame Blavatsky, the founder of a religion that worshipped Lucifer. Accordingly, both Margaret Sanger and Adolf Hitler were energized by the same "dark, spiritual forces." The fact that most of our citizens have never heard of Madame Blavatsky, theosophy, or that two of theosophy's most ardent disciples were Adolf Hitler and Margaret Sanger clearly reflects the degree of control that exists over what the American people have been allowed to learn about the occultic forces at work in our nation today.

As a researcher on the subject of the occult, I regularly receive letters and publications from the Lucis Trust. The Lucis Trust of today is the modern-day extension of the "Lucifer Publishing Company," an organization founded by Alice Bailey during the early years of the twentieth century. Alice Bailey was a disciple of Madame Blavatsky and the nominal leader of the Theosophical Society between the early 1900s and the late 1920s. Because the name "Lucifer" had such a bad connotation in those days, Alice Bailey changed the name of her organization from "The Lucifer Publishing Company" to "The Lucis Trust." The nature and beliefs of her organization, however, have always remained the same. The Lucis Trust of today is one of the major front groups through which theosophy works to influence life here in America. The supernatural powers that still energize The Lucis Trust today certainly come from the same dark, spiritual forces that energized Madame Blavatsky, Adolf Hitler, and Margaret Sanger in generations past.

Dachsie
2nd February 2021, 05:09 PM
The Population Control Agenda
Part 2 of 2
Stanley Monteith M.D.

____________________

Publications from The Lucis Trust regularly refer to "The Plan" for humanity that has been established by "The Hierarchy." Part of that plan is inscribed on the great granite pillars of the American Stonehenge in Elberton, Georgia ... "The Georgia Guidestones." 13

A full discussion on the subjects of population control and occultism is far beyond the scope of this short monograph. Full documentation on these subjects will be found in my soon-to-be-published book, "None Dare Call It Genocide." At this point let me simply offer a few examples of the views expressed by those who publicly advocate population reduction and/or genocide.

David Graber, a research biologist with the National Park Service, was quoted in the Los Angeles Times Book Review Section, October 22, 1989, as saying: "Human happiness and certainly human fecundity are not as important as a wild and healthy planet. I know social scientists who remind me that people are part of nature, but it isn't true ... We have become a plague upon ourselves and upon the Earth ...Until such time as homo sapiens should decide to rejoin nature, some of us can only hope for the right virus to come along." 14

Michael Fox, when he was the vice-president of The Humane Society of the United States wrote, "Mankind is the most dangerous, destructive, selfish and unethical animal on the earth." 15

In "The First Global Revolution," published by The Council of the Club of Rome, an international elitist organization, the authors note that: "In searching for a new enemy to unite us, we came up with the idea that pollution, the threat of global warming, water shortages, famine, and the like would fit the bill. All these dangers are caused by human intervention ...The real enemy, then, is humanity itself." 16

he Los Angeles Times of April 5, 1994 quoted Cornell University Professor David Pimentel, speaking before the American Association for the Advancement of Science, as saying that, "The total world population should be no more than 2 billion rather than the current 5.6 billion."

In the UNESCO Courier of November 1991, Jacques Cousteau wrote: "The damage people cause to the planet is a function of demographics - it is equal to the degree of development. One American burdens the earth much more than twenty Bangladeshes ... This is a terrible thing to say. In order to stabilize world population, we must eliminate 350,000 people per day. It is a horrible thing to say, but it's just as bad not to say it."17

Bertrand Russell, in his book, "The Impact of Science on Society," wrote, "At present the population of the world is increasing ... War so far has had no great effect on this increase ... I do not pretend that birth control is the only way in which population can be kept from increasing. There are others ... If a Black Death could be spread throughout the world once in every generation, survivors could procreate freely without making the world too full ... the state of affairs might be somewhat unpleasant, but what of it? Really high-minded people are indifferent to suffering, especially that of others." 18

egative Population Growth Inc. of Teaneck, New Jersey recently circulated a letter stating their long-range goal. "We believe that our goal for the United States should be no more than 150 million, our size in 1950. For the world, we believe our goal should be a population of not more than two billion, its size shortly after the turn of the century." 19
n the Global Assessment Report of UNEP (a United Nations sponsored study group), Phase One Draft, Section 9, the authors quoted an expert who suggested that: "A reasonable estimate for an industrialized world society at the present North American material standard of living would be 1 billion. At the more frugal European standard of living, 2 to 3 billion would be possible." 20

More New Age Influence

Speaking at a round-table discussion group at the Gorbachev Conference held in San Francisco in the fall of 1996, Dr. Sam Keen, a New Age writer and philosopher stated that there was strong agreement that religious institutions have to take a primary responsibility for the population explosion. He went on to say that, "We must speak far more clearly about sexuality, contraception, about abortion, about values that control the population, because the ecological crisis, in short, is the population crisis. Cut the population by 90% and there aren't enough people left to do a great deal of ecological damage."

Mr. Keen's remarks were met with applause from the assembled audience made up largely of New Age adherents, Socialists, Internationalists and occultists. Many of the leading occultists of our modern world attended that meeting in San Francisco, a meeting organized by Mikhail Gorbachev, former Director of the Soviet KGB, and later President of Russia. 21

What is the message found on The Georgia Guidestones? What is the plan of the "guides"? If you read occultic literature, you will soon find that those who worship Lucifer today refer to a "Hierarchy" that guides both their actions and the affairs of the world. Who are the "Hierarchy"? The Lucis Trust, formerly The Lucifer Publishing Company, recently sent a letter to their supporters stating, "The spiritual Hierarchy makes definite use of the twelve spiritual Festival periods. We can learn to cooperate with the members of the Hierarchy as they work to bring the divine Plan to the attention of men and women of goodwill and spiritual aspiration everywhere throughout the world. The idea of spiritual approach - of Hierarchy to humanity and humanity to Hierarchy - is the primary principle underlying meditation ...understanding of how the spiritual energies which flow through each zodiacal sign can illumine and inspire right human relations." 22

The ancient Druids were members of an occultic religion; the circle of monuments at Stonehenge in England is occultic; and the message engraved on the American Stonehenge in Elberton is occultic. Yoko Ono is the widow of John Lennon, a man who was deeply involved in the occult. Yoko Ono has written a musical score with three movements dedicated to the message of The Georgia Guidestones. She was recently quoted as saying, "I want people to know about the stones ...We're headed toward a world where we might blow ourselves up and maybe the globe will not exist ... it's a nice time to reaffirm ourselves, knowing all the beautiful things that are in this country, and The Georgia Stones symbolize that." 23

What is the message to modern-day man which is engraved on the great stone pillars of the Druid-like monument in Elberton? The first of the "guides" reads: "Maintain humanity under 500,000,000 in perpetual balance with nature. (This-Ed.) Means the entire human race at its climax level for permanent balance with nature."

he Infamous Tuskegee Study

In recent history, we have seen the influence of occultic population control advocates here in America. Nowhere is that influence better demonstrated than in the Tuskegee Study, a scientific research program in which 400 syphilis-infected black men were recruited by the U.S. Public Health Service back in 1932. The participants were all told that they would be treated for their infections, but instead of treating their illness, all medicines were withheld. The black men were then actively prevented from obtaining treatment elsewhere as their bodies, and the bodies of their wives and children, were systematically ravaged by disease.

The evil men who conceived that Nazi-style study justified their atrocity by alleging that scientists needed to learn how untreated syphilis progressed in the human body. For a period of forty years, between 1932 and 1972, the genocidal Tuskegee Study continued. It was not until 1972, when one newspaper finally had the courage to break the story to the public, that the Tuskegee Study was finally terminated. By that time, only 125 of the original 400 black men had survived.

To this very day, 24 years after the end of that grotesque human experiment, none of the perpetrators of that atrocity have ever been either accused or indicted for their crimes. Back in 1932, when the Tuskegee Study began, Margaret Sanger's ideas had already begun to infect the minds and souls of physicians and scientists here in America. According to Margaret Sanger's sense of morality, experiments on "human weeds" were fully justified in the name of "science." Do you honestly believe for one moment that such an experiment would have been tolerated here in America had the participants been white men? 24

Another far more effective method of reducing the world population was devised in the early 1960s by a group of environmentalists and population-control adherents. They set out to block the use of DDT for mosquito and malaria control after it had been found that the insecticide was extremely effective in saving human lives.

Alexander King, president of the Club of Rome, wrote, "My own doubts came when DDT was introduced. In Guyana, within two years, it had almost eliminated malaria. So my chief quarrel with DDT,in hindsight, is that it has greatly added to the population problem." 25

In 1970 The National Academy of Sciences, in their book "Life Sciences," stated that, "In little more than two decades DDT has prevented 500 million deaths due to malaria."
To population-control advocates, this irresponsible preservation of human life was unconscionable, so they set out to outlaw further use of the pesticide. Up until 1970 all reliable scientific data had consistently demonstrated that DDT was completely safe for both humans and animals. Indeed, DDT was the safest pesticide ever known to mankind. Furthermore, it was inexpensive and could be widely used in third-world countries to control the spread of insect-borne diseases. Accordingly, population-control adherents set out to have DDT banned in the name of saving the environment.

You have probably read the contrived stories alleging that DDT caused softening of eggshells, interfered with the balance of nature, and endangered humanity by entering into the food chain. In truth, all of those stories were fabricated, and were simply part of a carefully coordinated program to block further use of the life-saving pesticide. If you are interested in learning the truth concerning the deceitful campaign waged against DDT, I suggest that you order a copy of my audio-taped interviews with Dr. J. Gordon Edwards. Dr. Edwards is a world-renowned biologist who led the fight in the 1960s to counter the propaganda program waged by environmentalists and population-control advocates to ban further use of DDT. You can also order a copy of Dr. Edward's excellent monograph, "Remembering Silent Spring and its Consequences."

William Ruckelshaus was a long-time member of the Environmental Defense Fund, and the Director of the EPA. He outlawed further use of DDT in 1972 despite the recommendation of the chairman of the EPA investigating committee which had heard six months of testimony on use of the pesticide, and had determined that DDT was completely safe. When Ruckelshaus outlawed further use of DDT, he signed the death warrant for hundreds of millions of helpless human beings living in third-world countries. To those energized by the dark side, however, the loss of hundreds of millions of human lives was relatively inconsequential.

In his excellent monograph, "Remembering Silent Spring and its Consequences," Professor J. Gordon Edwards quoted from a speech delivered by Victor Yanconne, founder of the Environmental Defense Fund. In that talk, Mr. Yanconne related a story told to him by a reporter who had asked Dr. Charles Wurster, one of the major opponents of DDT, whether a ban on DDT wouldn't actually result in far greater use of much more toxic pesticides. Dr. Wurster is reported to have replied: "So what? People are the cause of all the problems. We have too many of them. We need to get rid of some of them and this is as good a way as any." hen asked by the same reporter, "Doctor, how do you square the killing of people with the mere loss of some birds?" Dr. Wurster is reported to have replied, "It doesn't really make a lot of difference, because organo phosphate acts locally and only kills farmworkers and most of them are Mexicans and Negroes." 26

How many people have died in the past 25 years since the use of DDT was outlawed? If the National Academy of Sciences was correct in their 1970 assessment that 500 million lives had been saved by DDT over a twenty-year period, then we have probably lost well over 600 million human lives during the past twenty-five years since advocates of population control succeeded in outlawing DDT. 27

The Relationship Between Abortion, Breast Carcinoma, and Population Control
Let me offer another example of a population control program which is being promoted here in the United States today. Many physicians have expressed their concern about the dramatic increase in breast carcinoma seen in women in recent years.

Despite the fact that 18 scientific studies published in both domestic and foreign medical journals have clearly demonstrated the direct causal relationship between first-trimester abortion and breast cancer, all efforts to disseminate that information here in the United States have been consistently blocked by those who favor abortion and population control. In the fall of 1996 a new scientific paper dealing with a meta-analysis of 23 different scientific studies on the relationship between first-trimester abortions and breast cancer was published in a British medical journal.

That study clearly demonstrated a higher incidence of breast cancer in women who had had first-trimester abortions. In response to that publication, the American Medical Association (AMA), the American Cancer Society (ACS), and pro-abortion/population-control advocates joined together in an unholy alliance to attack the conclusions of the authors, and to block all efforts to disseminate that information to American physicians. All of the organizations mentioned above continue to oppose efforts to have physicians warn women of the risk they face when they submit themselves to first-trimester abortions. Before carrying out all surgical procedures in America "advised consent" is required, except for abortion.

The AMA. the ACS, and the pro-death lobby continue to insist that women must not be advised of the risk they incur when they destroy the life of their unborn child. Why is there such inconsistency? Current abortion policies in America are absolutely necessary to reduce our population. That is why a minor child can be taken from school to an abortion clinic without parental notification, yet that same child cannot be given an aspirin without parental consent. It all has to do with population control. 28

Population Control in Russia Today

Another dramatic example of population control is the tragedy being played out in the "former" Soviet Union today in regard to male longevity. In Russia, the life span of the average Russian male has dropped precipitously over the past several decades. The average life expectancy of an American male is 74-78 years of age, and in Japan the average life span is 78 years, but the average life span of Russian men has fallen from 68 years in the 1970s to 63.8 years in 1985, to 57.7 years in 1994. It is estimated that, if current trends continue, the average life span of a Russian male will be 53 years shortly after the turn of the century. Do you really believe that this shocking reduction in life span is happening simply by "accident"? The true cause of this dramatic reduction in life span in Russia will be detailed in my coming book, "None Dare Call It Genocide." 29

The Massacres in Africa

One has only to learn what really happened to the Christians in Rwanda between April and July of 1994 to imagine what may lie in store for Christians here in America at some time in the not-too-distant future.

After the Christian Tutsis had been disarmed by governmental decree in the early 1990s, Hutu-led military forces began to systematically massacre the defenseless Christians.
The massacre began in April 1994 and continued until July 1994. Using machetes rather than bullets, the Hutu forces were able to create a state of abject fear and terror within the helpless Christian population as they systematically butchered hundreds of thousands of them. The United Nations immediately convened hearings on the genocide taking place in Rwanda, but Madeline Albright, the American Ambassador to the United Nations, argued strenuously that neighboring African nations should not be allowed to intervene until the "civil war had come to an end." In reality, of course, there was no civil war since those being slaughtered had no weapons with which to defend themselves; it was simply a matter of mass murder.

In addition to blocking intervention by neighboring nations, Madeline Albright also insisted that the word "genocide" must not be used, and that the United Nations forces stationed in Rwanda were not to be allowed to intervene. In the three months that followed, between one-half and three-quarters of a million Christians were systematically dismembered, hacked to death, and slaughtered in the bloody carnage that ensued. Tens of thousands of Christians were murdered in their churches; tens of thousands more were murdered in their hospitals and in their schools. On several occasions, United Nations soldiers stationed in Rwanda actually handed over helpless Christians under their protection to members of the Hutu militia. They then stood by as their screaming charges were unceremoniously hacked to pieces.

At the end of the carnage, in late July 1994, the American government rewarded the Hutu murderers with millions of dollars in foreign aid. Strangely, the American press has remained silent about the fact that almost all of those who were slaughtered were Christians, and it was the policies of our government that were primarily responsible for blocking efforts by neighboring African countries to intervene. 30

There are literally dozens of other examples of population- control programs which have been implemented throughout our world by modern-day "Malthusians" in their effort to ensure that the world population is dramatically curtailed. To date it is estimated that far more than one billion human lives have been terminated as a result of the world-wide abortion programs financed by the United States. In addition, we are beginning to see the devastating effects of the AIDS epidemic as this modern-day plague begins to depopulate large areas of both Asia and Africa. Because of the influence of occultic population controllers, however, all logical efforts to address the HIV epidemic throughout the world continue to be blocked. Rather than utilizing the proven public health methods used with all other illnesses, advocates of population control continue to promote both hedonistic sex education and condom distribution. In the May 1996 issue of "Special Warfare," a publication of the John F. Kennedy Special Warfare Center and School, it was noted that: "The immediate future may present other daunting challenges to Civil Affairs units. Because of complicated social and cultural reasons, AIDS already infects a high proportion of the military and civilian officials of Zaire, Uganda, Kenya, Zambia, and other central Africa countries. In some or all of these countries, government establishments may collapse in the next 10-15 years. If this pattern is repeated in other areas where AIDS is spreading at an alarming rate, then civil rule may also erode or break down in parts of North Africa, the Middle East, India, and Southeast Asia." 31

Let me assure you that there really are hundreds of thousands of occultly energized people throughout the world today who honestly believe that human compassion is outmoded, and that the inferior peoples of the world must either be allowed to die or be actively exterminated. I will conclude this monograph by quoting from the writings of the English Churchman, Thomas Robert Malthus (1766-1834). In his "An Essay on the Principle of Population," Malthus wrote: "All children born, beyond what would be required to keep up the population to a desired level, must necessarily perish, unless room may be made for them by the deaths of grown persons ...Therefore ...we should facilitate, instead of foolishly and vainly endeavoring to impede, the operations of nature in producing this mortality..." 32

I personally believe that God expects each and every of us to become involved in the affairs of this world until He returns. Furthermore, I believe that all human life is sacred. We are told that Christians are to be the "salt and light of the world," the preservative that keeps humanity from rotting. What is the Christian Church doing today to preserve the lives of the inhabitants of God's earth; what are you doing to protect the lives of those who have been targeted by the forces of darkness? Today, the AIDS epidemic is beginning to depopulate both Africa and the non-Communist countries of Asia? What can you do?

A. Order my taped interview with Peter Hammond which tells the story of the murder of the Christian population of Rwanda.

B. Order my four-tape set on Population Control which includes information on The Georgia Guidestones and the plan of the "guides." You have my permission to copy and distribute my audio tapes and this monograph, in order to disseminate this information as far and wide as possible.

C. Get involved in local political organizations. Speak out on these matters on talk-radio, in your church, and to your friends. The life you save could well be that of a loved one ...a friend ...or your own.

D. Finally, pray that our Lord will intervene, and that our nation can be returned to Godly leadership.

Always remember the words of St. Paul from Ephesians 6:11-12 - "For we struggle not against flesh and blood, but against principalities, against powers, against the forces of the darkness of this world, against spiritual wickedness in high places."

End Notes: 1) Copies of the material obtained in Elberton, Georgia, on The Georgia Guidestones, and a four-audio-tape set on "Population Control" are available from Radio Liberty: P.O. Box 13, Santa Cruz, CA, 95063.

2) Bartlett's Familiar Quotations: Fifteenth Edition: Little, Brown, and Company: p. 824.

3) Killer Angel: George Grant: Reformer Press: p 105: available from Radio Liberty: P.O. Box 13, Santa Cruz, CA, 95063.

4) ibid: page 65

5) ibid p 65, 71-72, 92: see also Pivot of Civilization: Sanger: New York: Bretano's: pp 101,108,123:

6) Woman's Body, Woman's Right: Linda Gordon: New York: Penguin Press: p 204: see also: Killer Angel: p 64

7) Woman's Body, Woman's Right: p 332: see also Killer Angel: p 73

8) Killer Angel: p 74: see also: Woman's Body, Woman's Right: Linda Gordon: New York: Penguin Press: pp 229-334.

9) Woman's Body, Woman's Right: pp 229-334: see also Killer Angel: p 73

10) Killer Angel: p 104

11) Killer Angel: p 90: see also The Dark Side of Freemasonry: Decker: Huntington House: p 71: equating Satan with the "white deity": see also: The Hidden Dangers of the Rainbow:

Cumbey: Huntington House: available from Radio Liberty.

12) Warrant for Genocide: Cohn: Harper and Rowe: 1966: p 15.

13) Killer Angel: op cited: p 90: see also: Hitler and the New Age: Rosio: Huntington House: Available from Radio Liberty. P.O. Box 13, Santa Cruz, CA, 95063: see also the Radio Liberty interview with Aaron Zellman: see also The Pagan Agenda: tape series available from Radio Liberty: See also The Aquarian Conspiracy by Marylin Ferguson: see also The Hidden Dangers of the Rainbow: Constance Cumbey: available from Radio Liberty.

14) Los Angeles Times: Book Review Section: October 22, 1989: p 9.

15) Animal Rights: A New Species of Egalitarianism: The Intellectual Activist: September 14, 1983: p 3: Also quoted in The War on the West: William Perry Pendley: Henry Regnery: p 15.

16) The First Global Revolution: Club of Rome, Alexander King and Bertrand Schneider, 1991: Pantheon Books, New York, p 115

17) The Population Controllers: New American Magazine: June 27, 1994: p 7.

18) The Impact of Science on Society: Bertrand Russell: 1953: p xv.

19) Material is available from Radio Liberty, P.O. Box 13, Santa Cruz, CA, 95063.

20) The World Conservative Union: Rue Mauverney 28, CH-1196 Gland, Switzerland.

21) Copies of the text of Dr. Keen's remarks are available from Radio Liberty.

22) A copy of the letter quoted from The Lucis Trust is available from Radio Liberty for researchers.

23) Quotation from Yoko Ono was found on the web site: http:www.odysee.net%7Ericjoly/geostone.htlm#francisco. Copies available from Radio Liberty for researchers.

24) AIDS and the Doctors of Death: Aries Rising Press: Los Angeles: pp 168-170.

25) Remembering Silent Spring and its Consequences: J. Gordon Edwards: a monograph: p 7: available from Radio Liberty, or from Dr. Edwards at San Jose State University in San Jose, CA.

26) Reported by Chairman John Rarick: House Hearings on the Federal Pesticide Control Act of 1971, pp 266-267, in Serial No 92-A: quoted in a treatise by Dr. J. Gordon Edwards: A taped interview with Dr. Edwards is available from Radio Liberty, as is his treatise: see also Environmental Overkill: Dixy Lee Ray: Regnery: p 77.

27) Environmental Overkill: op cited: pp 76-77 and 192: see also my 2-hour interview with Dr. Dixy Lee Ray: see also Dr. Edwards' treatise on DDT, available from Radio Liberty.
28) Strong Abortion-Breast Cancer Link Revealed: Washington Times: October 12, 1996: A1.

29) Russia Strives to Reverse Population Shrinkage: Washington Times: September 22, 1996: p A8.

30) An audio-taped interview with Peter Hammond of Front Line Ministries is available from Radio Liberty: also see Holocaust in Rwanda: Peter Hammond: available from In Touch Mission Int'l (ITMI), P.O. Box 28240, Tempe, AZ, 85285.

31) Special Warfare: May 1996: PB 80-96-2: Special Operations and LIC in the 21st Century: The Joint Strategic Perspective: Brian Sullivan: p 2.

32) Killer Angel: op cited: pp 50-51.

[/SIZE]

Dachsie
3rd February 2021, 11:16 AM
This article contributes a greater degree of clarity to the average reader, however it omits the information that SARS-COV-2 has never itself been isolated and therefore what the PCR test says is SARS-COV-2 is really the foundational fake science lie in this Satanic PLANdemic to inflict a ONE WORLD DEATH AND SLAVERY SYSTEM for ALL.


https://www.mostholyfamilymonastery.com/news/the-pcr-test-for-covid-19-identifies-only-human-dna/#.YBrhqXlMHIU

"The PCR Test For COVID – 19 Identifies Only Human DNA"



(https://www.mostholyfamilymonastery.com/news/the-pcr-test-for-covid-19-identifies-only-human-dna/#.YBrhqXlMHIU)

investmentwatchblog.com

“Amandha Dawn Vollmer is a doctor of Naturopathic Medicine from the Canadian College of Naturopathic Medicine in Toronto and has a bachelor’s degree in Agricultural Biotechnology. She found that the COVID-19 test does not actually test for COVID-19. The test itself is a polymerase chain reaction (PCR) test that identifies DNA particles.

She found that the PCR testing protocol developed by the World Health Organization (WHO) to detect COVID-19 actually tests for chromosome 8, which is present in all humans. One of the ‘primer’ sequences (the start sequence) in the PCR test for SARS-CoV-2, which is used by the WHO, is found in any human DNA. In essence, we are the ‘virus’.

https://www.investmentwatchblog.com/wp-content/uploads/2021/01/2021-01-26_08-57-47.png

The COVID-19 test is done using reagents to extract an RNA sample. An enzyme called reverse transcriptase converts RNA into a complementary DNA sequence. DNA (called ‘primer’) is reproduced (amplified) several times so that the sought DNA sequence can be detected. The more replication cycles, the more likely it is that the targeted sequence will be detected.

Sometimes chromosome 8 (aka ‘COVID-19)’ is detected, other times it is not detected by the PCR test. The reason why it is not always detected is that the PCR test sample (‘primer’) must be amplified. And if the ‘primer’ is not sufficiently amplified, the DNA sequence will not be identifiable. This is the scam. If amplified sufficiently, what has been identified as the’ COVID-19 virus ‘ (aka chromosome 8) will always be detected. That limit point for amplification cycles determines a positive or negative result.

Now you know why the test gives 80% false-positive results for COVID-19 and why so many people tested positive are described as asymptomatic. They don’t have any COVID-19. They have what everyone has, chromosome 8.

ctccctttgttgtgttgt = DNA sequence for the PCR test of ‘COVID-19’

ctccctttgttgtgttgt = chromosome 8, present in all humans

Anyone can be declared positive with this PCR test. It only needs to be replicated (amplified) the DNA in the ‘primer’ again and again, until a positive result is obtained. According to the Center for Evidence-Based Medicine, ‘the higher the viral concentration, the fewer amplification cycles are required.’ In order for a person to come out positive, it only matters how much DNA from chromosome 8 of the tested subject is found in the ‘primer’ sample, in the equation with the number of multiplication cycles.

Every time the DNA in the sample is amplified, it doubles its number of molecules. Doubling is exponential after each amplification cycle. But the number of cycles can vary from laboratory to laboratory. The probability that the test will come out positive increases depending on the number of cycles. Cycles for a COVID-19 test usually range from 20 to 30 cycles, but there are tests with 45 cycles, to which absolutely everyone comes out positive. The number of cycles is completely arbitrary.

If there is enough material, then the person will come out positive according to the number of amplifications as per the WHO protocol. The test protocol indicating how many times a ‘primer’ is amplified is set arbitrarily and can be reset arbitrarily, depending on the needs of the state. You know, it’s like organized crime!”


https://www.investmentwatchblog.com/wp-content/uploads/2021/01/2021-01-26_08-58-44.png

PatColo
3rd February 2021, 11:41 AM
rense hr 2 last night, 51 mins

Download (https://ln2.sync.com/dl/a2eeee650/27pks9cm-emwh6hpp-rrh3fz4m-6b85m5fv) Hour 2 - Dr. Erica Khan - A closer look at Corona 'Vaccines' ...Close To 400 Already dead in US

Dachsie
3rd February 2021, 12:12 PM
rense hr 2 last night, 51 mins

Download (https://ln2.sync.com/dl/a2eeee650/27pks9cm-emwh6hpp-rrh3fz4m-6b85m5fv) Hour 2 - Dr. Erica Khan - A closer look at Corona 'Vaccines' ...Close To 400 Already dead in US

This guest, Dr. Khan, had some important facts on this subject but Rense kept interrupting her with useless comments and would not let her finish a sentence. I could only liste to half and gave up.

did pick this artwork from rense.cim today

https://rense.com//1.mpicons/gates-vax02.jpg

https://rense.com//1.mpicons/gates-vax02.jpg

Also picked this up from Rense...

https://nypost.com/2021/02/01/rutgers-researcher-creator-of-covid-19-saliva-test-dead-at-51/

Rutgers researcher who created first COVID saliva test dead at 51

By Natalie Musumeci

February 1, 2021 | 10:40am | Updated
New Jersey Gov. Phil Murphy paid tribute to Andrew Brooks, who developed the COVID-19 saliva test
Video Player is loading.
0:09
/
1:50




A research professor at Rutgers University who developed the first saliva test for the coronavirus has unexpectedly died, the college said.

New Jersey native Andrew Brooks, 51, passed away on Jan. 23, the university said in a statement, without elaborating.

As the chief operating officer and director of technology development at RUCDR Infinite Biologics, Brooks led the effort to develop the COVID-19 saliva test.

The test received emergency use authorization by the Food and Drug Administration in April and a month later was approved for at-home use.

More than 4 million of the rapid response tests have been performed since March, Rutgers University said.
Enlarge Image
Andrew Brooks holds a COVID-19 saliva test.
Andrew Brooks holds up a COVID-19 saliva test.Nick Romanenko

New Jersey Gov. Phil Murphy honored Brooks during a press briefing last week, calling him “one of our state’s unsung heroes.”

Murphy said the Rutgers COVID-19 test has “undoubtedly saved lives” as he praised the legacy Brooks has left behind.

“We cannot thank Andy enough for all he did across his career,’’ Murphy said. “He will be sorely missed by many.’’

Jay Tischfield, the founder and CEO of RUCDR, said in a statement that Brooks “will be fondly remembered by the large cohort of scientists whose research he facilitated across many years.”

Brooks was a research professor in Rutgers-New Brunswick’s School of Arts and Sciences in the Department of Genetics, an academic member of the Human Genetics Institute of New Jersey, a research faculty member in Rutgers’ Environmental and Occupational Health Sciences Institute and a member of its NIHS Center of Excellence.
see also

Cuomo expanding rapid COVID testing in bid to reopen restaurants, theaters

He was also a member of the graduate faculty in the Rutgers Joint Graduate Program in Toxicology.

Brooks received his doctorate in neuroscience from the University of Rochester and later became its director of medical center core facilities. Four years later, he returned to New Jersey to direct the joint Rutgers/UMDNJ EOHSI Bionomics Research and Technology Center.

He co-authored more than 70 publications and “played a key role” in providing consultation, biobanking and analytical services to many large research projects “that have yielded insights into the genomic etiology of human diseases and the effects of environmental exposures,” Rutgers said.

Brooks also served 17 years as an adviser to the FDA as director of the Harlan (now Envigo) GeneScreen Laboratory and as co-founding director of the BioProcessing Solutions Alliance.

He is survived by his wife, Jil; three daughters, Lauren, Hannah and Danielle; his mother, Phyllis Brooks, his sister, Janet Green, and a niece and nephew.
Filed under Coronavirus , new jersey , rutgers , 2/1/21
Share this article:


Read More

Dr. Fauci Warns Four States Their COVID-19 Rates Risk Spiraling Out Control Dr. Fauci Warns Four States Their COVID-19 Rates Risk Spiraling Out Control www.iheart.com
Cancelled TV Shows: Effective Immediately Cancelled TV Shows: Effective Immediately The Delite
[Photos] Everyone Spotted The Same Thing Behind Prince Charles [Photos] Everyone Spotted The Same Thing Behind Prince Charles Maternity Week


This story has been shared 214,352 times. 214,352
John Travolta and daughter do 'Grease' dance in Super Bowl 2021 commercial

This story has been shared 103,310 times. 103,310
Reddit trader behind GameStop rally says he lost $13M in one day

This story has been shared 84,707 times. 84,707
5-year-old orphaned after parents killed in tragic cliff accident

“knewz
Video
This chilly dog burrowed inside his owner's bathrobe sleeve — while she was still wearing it. Watch the "head"-warming moment filmed in the Netherlands here.
Video length 49 seconds :49
Bathrobe sleeve is this dog’s favorite snuggle spot


Dr. Andrew Btooks, creator of the saliva test for "the virus" and meet untimely convenient death.

embedded video

A research professor at Rutgers University who developed the first saliva test for the coronavirus has unexpectedly died, the college said.

New Jersey native Andrew Brooks, 51, passed away on Jan. 23, the university said in a statement, without elaborating.

As the chief operating officer and director of technology development at RUCDR Infinite Biologics, Brooks led the effort to develop the COVID-19 saliva test.

The test received emergency use authorization by the Food and Drug Administration in April and a month later was approved for at-home use.

More than 4 million of the rapid response tests have been performed since March, Rutgers University

https://nypost.com/wp-content/uploads/sites/2/2021/02/Andrew-Brooks-01.jpg?quality=90&strip=all&w=1024

Andrew Brooks holds up a COVID-19 saliva test.

New Jersey Gov. Phil Murphy honored Brooks during a press briefing last week, calling him “one of our state’s unsung heroes.”

Murphy said the Rutgers COVID-19 test has “undoubtedly saved lives” as he praised the legacy Brooks has left behind.

“We cannot thank Andy enough for all he did across his career,’’ Murphy said. “He will be sorely missed by many.’’

Jay Tischfield, the founder and CEO of RUCDR, said in a statement that Brooks “will be fondly remembered by the large cohort of scientists whose research he facilitated across many years.”

Brooks was a research professor in Rutgers-New Brunswick’s School of Arts and Sciences in the Department of Genetics, an academic member of the Human Genetics Institute of New Jersey, a research faculty member in Rutgers’ Environmental and Occupational Health Sciences Institute and a member of its NIHS Center of Excellence.
see also

Cuomo expanding rapid COVID testing in bid to reopen restaurants, theaters

He was also a member of the graduate faculty in the Rutgers Joint Graduate Program in Toxicology.

Brooks received his doctorate in neuroscience from the University of Rochester and later became its director of medical center core facilities. Four years later, he returned to New Jersey to direct the joint Rutgers/UMDNJ EOHSI Bionomics Research and Technology Center.

He co-authored more than 70 publications and “played a key role” in providing consultation, biobanking and analytical services to many large research projects “that have yielded insights into the genomic etiology of human diseases and the effects of environmental exposures,” Rutgers said.

Brooks also served 17 years as an adviser to the FDA as director of the Harlan (now Envigo) GeneScreen Laboratory and as co-founding director of the BioProcessing Solutions Alliance.

He is survived by his wife, Jil; three daughters, Lauren, Hannah and Danielle; his mother, Phyllis Brooks, his sister, Janet Green, and a niece and nephew.
Filed under Coronavirus , new jersey , rutgers , 2/1/21

PatColo
3rd February 2021, 01:04 PM
This guest, Dr. Khan, had some important facts on this subject but Rense kept interrupting her with useless comments and would not let her finish a sentence. I could only liste to half and gave up.


in the last ~10m somewhere JR repeated some hearsay he couldn't verify but "rang true" - that Muh CHIY-NAH didn't want anyone entering the country who'd had either the pfizer or moderna vaxxes. It's not as though western MSM would disseminate such a story tho, with all its implications re what Muh CHIY-NAH knows about these vaxxes & what happens to ppl who get their jabs... We do know that when ppl get (REAL...) vaxxes they shed for 1-2 weeks & ppl around them get sick, & often they the vaxxed person gets sick as well.

first hour was
Download (https://ln2.sync.com/dl/200c5b780/y9hemxwm-ay2hpbgi-392jzz7h-vnabznxa) Hour 1 - Ted Broer (http://gsradio.net/shows/ted_broer/) - The Sorry and worsening state of affairs

who, from the past JR/Broer hours I've listened to b4... he brings an interesting world view but a little too Bible-thumpy for me.

3rd hour with reverse-speech guy is a write-off 4 me...:rolleyes:

Dachsie
3rd February 2021, 01:17 PM
https://rense.com//1.mpicons/gates-vax02.jpg

Dachsie
3rd February 2021, 01:45 PM
Here is a short audio-free video that is pro-vaccine and it is full of misinformation and disinformation and abounds in glaring omissions of certain "side effects" of a much more serious nature than the ones covered the video. (Is sudden death a side-effect?)


https://www.youtube.com/watch?v=OzOxpaA4MQI

YouTube cemsoring politicies make no judgment about content coming from approved sources but will not let patriot-type channel hosts even say the words Virus, vaccine, or coronavirus or Covid-19.

Dachsie
3rd February 2021, 02:46 PM
This is a more important daily TruNews report that I have decided to repost. I will not post all of weekday Coronavirus report shows.




https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-february-03-2021

TruNews Headlines with Kerry Kinsey - February 03, 2021
(https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-february-03-2021)

13:42 video runtime

Professor Dolores Cahill says, “The mRNA ‘vaccine’ leads your immune system to attack your own organs; then you die of organ failure.” She also says a forensic examination is needed to determine what’s in the shot.

David Knight says “Barney Fife types” will have a field day with the new CDC order that makes it a federal crime to use public transportation without a mask.

A study finds that long-term mask use may contribute to advanced-stage lung cancer. Video Clip of Dr. Ron Paul commenting on this.

On ‘Corona Crazy’, it could be the worst-case example of the cancel culture as a woman is fired for being on Parler.

Pastor John MacArthur says the darkness we are seeing right now from this administration is from people who’ve rejected God and he says laws are being made to criminalize righteousness.

Content Contributed By — TruNews Team

____________________

Dachsie comments from a non-medical person whose only specialty is dachsology.

The two stories in this video, about organ failure and lung cancer, are two situations that are non-immediate. The auto-immune activity of a vaccine recipient begins by attacking the recipient's own vital organs and that gradually over time leads to first sepsis and then organ failure and then death. Dr. Ron Paul mentioned the non-immediate ramifications of lung cancer from wearing the bacteria masks that restrict oxygen and breed bacteria in mouth flora and that leads to lung infection and metastatic lung cancer. Dr. Paul said even people with asthma should not wear masks for prolonged periods.

Most of the "Covid" vaccine "side effects" being mentioned by the medical establishment propagandists are only mentioning the mild non-scary immediate side effects that they know will not scare people into not choosing to receive the vaccine.

I think there are hundreds of thousands of people in the USA populace who suffer from an array of milder auto-immune conditions that they have to deal with over many years and practically all of these people have received one or more different kinds of vaccines over the years. There is an unspoken of connection between vaccines in general and chronic undiagnosed auto-immune inflammatory conditions and many people end up taking steroids for many years for these conditions. The diagnoses given for these conditions often ends in the suffix -itis and sometimes over time to suffix of -osis. These diagnoses seem often to be just the name of a symptom and not identification of a unique disease condition.

PatColo
3rd February 2021, 03:13 PM
I found CAFitts has a (blue check!) gab acct she opened last Nov, but didn't tell anyone @ twatter, & she only posted 78 'gabs' then seemed to abandon it, all in Nov!
https://gab.com/catherineaustinfitts

This Nov 12 story was her last gab

VAX THE BLACKS: Joe Biden’s Covid-19 taskforce member recommends withholding food stamps and rent assistance from those who refuse coronavirus vaccines (https://www.naturalnews.com/2020-11-12-starved-and-homeless-joe-bidens-covid-19-taskforce-vaccines.html)

Thursday, November 12, 2020 by: Mike Adams (https://www.naturalnews.com/author/healthranger)

Dachsie
3rd February 2021, 03:30 PM
I found CAFitts has a (blue check!) gab acct she opened last Nov, but didn't tell anyone @ twatter, & she only posted 78 'gabs' then seemed to abandon it, all in Nov!
https://gab.com/catherineaustinfitts

This Nov 12 story was her last gab

VAX THE BLACKS: Joe Biden’s Covid-19 taskforce member recommends withholding food stamps and rent assistance from those who refuse coronavirus vaccines (https://www.naturalnews.com/2020-11-12-starved-and-homeless-joe-bidens-covid-19-taskforce-vaccines.html)

Thursday, November 12, 2020 by: Mike Adams (https://www.naturalnews.com/author/healthranger)

Today's TruNws Coronavirus reports tells of a person was snitched on for just being a member of gab and they lost their job with the company that formally apologized for having a person on this staff who belonged to an "offensive" forum of this kind. This was not a complaint about the content of the member but just the evidence that the person was signed up with gab.

Dachsie
3rd February 2021, 03:35 PM
https://thefreedomarticles.com/covid-cult-and-the-10-stages-of-genocide/

thefreedomarticles.com


How it Promotes the 10 Stages of Genocide (https://thefreedomarticles.com/covid-cult-and-the-10-stages-of-genocide/)


Published 19 hours ago on February 2, 2021
11-14 minutes

https://397145-1250082-raikfcquaxqncofqfm.stackpathdns.com/wp-content/uploads/2021/02/covid-cult.jpg

How many people do you know are stuck inside the COVID Cult, trapped in fear, giving away their power and worshipping the official narrative?
The COVID Cult Marches On

in 2021, leaving natural unalienable rights, people’s livelihoods and human freedom decimated in its destructive wake. The US CDC (Centers for Disease Control and Prevention) has just tried to tell people they have to wear not 1 mask but 2 masks when traveling using some form of public transport: “Cloth masks should be made with two or more layers of a breathable fabric that is tightly woven.” This is the same CDC, you may recall, whose own figures were analyzed by Johns Hopkins researcher Dr. Genevieve Briand to show that there were no excess deaths in America in 2020. It is also the very same CDC, you may recall, that has admitted that it has never had any true viral isolate of the alleged novel virus SARS-CoV-2, and that it concocted the digital SARS-CoV-2 genome of 30,000 base pairs from an actual specimen of 37 base pairs. The consequences of this giant fraud are far-reaching; the COVID cult appears to be enabling the NWO (New World Order) manipulators to carry out the 10 stages of genocide, which was a theory of American scholar Dr. Gregory Stanton. He applied his theory to past genocides in history. However, the same process and stages seem to be happening right before our eyes in the COVID plandemic. These stages/steps don’t necessarily take place in a linear fashion; they may also take place simultaneously. Hat tip to Henna Maria for her video analyzing how these stages apply to the COVID cult and scamdemic.

https://397145-1250082-raikfcquaxqncofqfm.stackpathdns.com/wp-content/uploads/2021/02/covid-world-bank-2025.jpg

The World Bank classifies COVID as a project ending in March 2025.
The Planned SPARS Pandemic and the Limits of Tyrants

Before we get into the 10 stages, we all need to realize that the COVID scamdemic isn’t going anywhere. It’s only going to get worse until enough people stand up and challenge it. If the masses continue to act as acquiescent zombies, this fake pandemic may be pushed all the way until 2025, and will probably be ‘augmented’ with a false flag bio terror attack or a “Pandemic II” as NWO frontman Bill Gates predicted. Diana Lenska exposed another simulation called the The SPARS Pandemic which details a scenario where a new virus infects humanity in 2025, and lasts until 2028. We all how know how these ‘simulations’ have a strange and disturbing habit of becoming real … just a coincidence, of course. At this juncture, it is worthwhile remembering this very important quote from Douglass Frederick:

“The limits of tyrants are prescribed by the endurance of those whom they oppress.“

Gates and his Pandemic II, the CDC and its 2 masks, Biden and his 100-day mask mandate – all tyrants seeing how far they can push you into accepting their control and tyranny, and the abrogation of your rights. The World Bank classifies COVID as a “project” that is planned to continue until the end of March 2025 (see above image). Are you going to accept this?
1st Stage: Classification

I believe this word is meant in the sense of “to separate into different classes (of people)” rather than as a noun that comes from the verb to classify. Regardless, this stage is all about separating people from each other, dividing people into different classes and introducing the Us vs. Them mentality. In the past, this was done along the fault lines of ethnicity, race, religion or nation. Now, in the context of the COVID cult, it’s done according to who believes and who rejects the COVID cult narrative. If you are a dissenter or non-believer, you are being singled out for your thoughtcrime. If you stand for medical sovereignty or bodily autonomy, you are being put into a separate class.
2nd Stage: Symbolization

Symbols are used in many ways. Symbolization is used here to make the targeted group, who are enemies of the state, stand out as ignominious and conspicuous dissenters or traitors. In the times of 3rd Reich, the Nazis forced the Jews to wear a yellow star as a symbol that they were in a different class. In the COVID cult, this is done through reverse psychology: model citizens of the NWO cover their faces, but those outside the COVID cult refuse to cover their face. By refusing to wear a mask, these dissenters voluntarily make themselves a highly visible target.
3rd Stage: Discrimination

Discrimination is illegal in many nations, but that doesn’t seem to matter in the COVID cult. Centuries-old legal traditions and human rights have been trampled underfoot. The government has used not wearing a mask as a pretext for the mass denial of rights, including but not limited to rights such as the right to freely travel, the right to freely earn a living and run one’s own business, the right to freely trade with others and the right to enter public places. Discrimination is a way of tightening the screws and increasing the pressure for what is next to come.
4th Stage: Dehumanization

This intensity picks up in this next stage. Dehumanization always seems to be a necessary precondition to murder, since it involves making the target appear less than human, not valuable and unworthy in the eyes of the killers-to-be. Generally, the targeted group is robbed of its humanity through labels, insults and characterizations which all emphasize distinctions rather than the commonality of what all of us humans have regardless of our differences. In terms of the COVID cult, heretics are branded fanatics, selfish, extreme, disease-spreaders, super-spreaders, domestic terrorists, asymptomatic carriers, anti-vaxxers, conspiracy theorists and much more. In 2019, the WHO (World Health Organization) declared vaccine hesitancy (and by extension ‘anti-vaxxers’) among the top 10 threats to global health.
5th Stage: Organization

Past genocides consisted of war, mass murder, bloody massacres and/or mass graves. If a genocide comes from the COVID operation, it will be less sensationalistic. Operation coronavirus is a silent operation using fear, trauma-based mind control and other ritualistic elements. It has the hallmarks a false flag operation like 9/11; look at the history of false flag ops and the history of fake pandemics. In this stage, the government begins actively organizing its police and military forces against those it has branded enemies.
6th Stage: Polarization

In my opinion, this stage is very comparable to the first stage, or is just an intensification of it. If you are a social engineer, once you have separated the masses into different classes, you can then further entrench that division via polarization, setting the groups into mutual antagonism against each other. This has been happening for years in the US anyway, even before Operation Coronavirus was launched, and was exacerbated by Trump, wittingly or not. Things have reached a low point in the US where it seems many Americans cannot simply remember they are both human, or both American, and feel the need to dehumanize their ‘opponent’ if he or she is not on the correct political team. Whatever happened to being able to agree to disagree, or being mature enough to accept others have opposing views to yours? In the COVID cult, the NWO controllers have deliberately fueled the fire between the masses and the discriminated aware minority via the MSM, which constantly spreads propaganda that healthy people are asymptomatic carriers.
7th Stage: Preparation

This stage of preparation involves things like isolation and quarantine camps. Politicians have been suggesting detainment camps (i.e. prisons) for those who refuse to embrace the COVID cult. There have been rumors for decades in the US about alternative uses for FEMA camps. If you don’t have the “mark”, you’re out of luck, and you’re either excluded from society, excluded from commerce or literally imprisoned. Right now the mark is a mask, but next it will be the vax (and its extension – the vaccine certificate or immunity passport), and finally the microchip. Last month The Telegraph reported that Germany was building quarantine detainment camps for COVID violators.

Germany. Detainment camps. Hmmm.

What could possibly go wrong?
8th Stage: Persecution

At this stage, all the silent and covert preparations leading up to this point become overt. In the past, the identified targeted group was imprisoned, deported and/or their property was seized. In some states and nations, it is already law that the property of an “infected individual” can be seized and destroyed to “stop the spread of the virus.” Cops are harassing peaceful citizens who don’t wear a mask. What will happen as the COVID cult agenda reaches its conclusion?
9th Stage: Extermination

I hope it never gets to this point, but sad to say it’s important not to underestimate the scale of sheer evil that is behind the NWO and the COVID cult. Extermination is mass murder; the ultimate way to shut down all dissent and opposition to tyranny.
10th Stage: Denial

Dr. Stanton notes there is a final stage: denial. This includes hiding the evidence, murdering the witnesses and blaming the victims. In the context of the COVID cult, teachers would reinforce the lie, and cement the dehumanization, by telling children that physical touch can injure or kill, despite the obvious truth that human touch is an innate human need.
Final Thoughts on the COVID Cult and Its Implications

I write this as a warning of what could happen (in the hopes that it can be averted) not as a prediction of what will happen. This information underpins the need all the more for us to fully humanize (not dehumanize) in the face of the COVID cult, which like the NWO itself, is a decidely anti-human agenda. It also underpins the need for us to come together regardless of petty differences, and refuse to participate any more in the polarization (us vs. them) that is being foisted upon us. This is one of the main reasons why The Freedom Articles is non-partisan and always will be. I refuse to pick political sides like it’s a game of football, when both sides are deeply corrupt and when both sides are controlled by the exact same force. We need to stop wasting our time with political theater of no consequence.

Every single person on Earth has a choice to make. Will you dutifully wear the mask, get the shot (the COVID vaccine which is not a vaccine) and ultimately accept the microchip or nanochip? Or will you stand for medical sovereignty and bodily autonomy? The COVID agenda is already forcing you to choose a side, and so much is riding on your choice, not least your children’s future, and the future of humanity on Earth.

*****

Makia Freeman is the editor of alternative media / independent news site The Freedom Articles, author of the book Cancer: The Lies, the Truth and the Solutionsand senior researcher at ToolsForFreedom.com. Makia is on Steemit and Parler.

Sources:

*https://www.cdc.gov/quarantine/masks/mask-travel-guidance.html

*https://www.bitchute.com/video/3ihv9O0UBS4B/

*https://thefreedomarticles.com/10-reasons-sars-cov-2-imaginary-digital-theoretical-virus/

*https://www.genocidewatch.com/tenstages

*https://www.bitchute.com/video/IsHZXjvNVVQb/

*https://153news.net/watch_video.php?v=D4AK7R368G1U

*https://humansarefree.com/2020/12/spars-pandemic-2025-2028-simulation-2017-coronavirus-plandemic-covid-19.html

*https://www.who.int/news-room/spotlight/ten-threats-to-global-health-in-2019

*https://thefreedomarticles.com/exposing-the-occult-corona-initiation-ritual/

*https://thefreedomarticles.com/9-11-covid-similarities-16-glaring-parallels/

*https://thefreedomarticles.com/category/conspiracy/false-flag-ops-staged-terror-events/

*https://thefreedomarticles.com/same-fake-pandemic-similarities-1976-swine-flu-2020-covid/

*https://www.telegraph.co.uk/news/2021/01/17/germans-keep-refusing-quarantine-could-put-detention-centres/

*https://thefreedomarticles.com/not-a-vaccine-mrna-covid-vaccine-chemical-pathogen-device/

Dachsie
3rd February 2021, 03:46 PM
The photo of the Catholic mass with the caption "How many people do you know are stuck inside the COVID Cult, trapped in fear, giving away their power and worshiping the official narrative?"

is not probably the reason for the silly masks.

These "altar boys" are probably totally detached to what the masks are supposed to be for. They are wearing the masks so that the Church will be allowed by the government to keep on having mass at all and for fear that they will lose their 501c3 tax exempt status.

Attempts by Protestant groups to have church have been almost 95 percent ineffective no matter how many lawyers they hire to set up their entity without having tax exempt status.
To accept the tax exempt status is similar to the churches in NAZI Germany that had to display a swastika next to the pulpit in order to hold a religious assembly at all..

Dachsie
3rd February 2021, 03:53 PM
https://img.ifunny.co/images/25960f938674c4f52f6b05cf26fe6301db668375e020f75fbe 7123ace2c8868c_1.jpg

PatColo
3rd February 2021, 04:59 PM
Today's TruNws Coronavirus reports tells of a person was snitched on for just being a member of gab and they lost their job with the company that formally apologized for having a person on this staff who belonged to an "offensive" forum of this kind. This was not a complaint about the content of the member but just the evidence that the person was signed up with gab.

^ I listened; story ^ begins @ 7:40: https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-february-03-2021

she was stitched on for being on (((the since gassed))) parler, but commenters re the story lumped Gab in w Parler as being "alt-right"

Dachsie
3rd February 2021, 05:39 PM
I listened; story &^ begins @ 7:40: https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-february-03-2021she was stitched on for being on (((the since gassed))) parler, but commenters re the story lumped Gab in w Parler as being "alt-right"

Right. my bad. I heard reporter use the phrase "gab and parler" but the subject case originally reported was only involving parler. Both fall into the conservative category. The principle involved is that it is illegal in the USA to fire a person because of their personally held beliefs and personal free expression within the rules of a video and forum platform. That principle, among about all the other principles of our republic. are just all being thrown out the window right now. We no longer are a nation of laws and the rule of law. Period. The time to screen a person for their political philosophy is during the hiring process. That can break discrimination laws too.

Dachsie
4th February 2021, 01:41 AM
Unbiased report about Pfizer and Moderna serious side effects? NOT!



https://www.youtube.com/watch?v=DfxB2lmJags

...https://www.youtube.com/watch?v=DfxB2lmJags...

Moderna and Pfizer Vaccine Trial Participants Confirmed Serious Side Effects
311,248 views
•Oct 7, 2020
2.7K
345
Share
Save
ENewsTrends
44.9K subscribers
Two companies reported serious adverse events in some participants of COVID-19 vaccine trial.
1,166 Comments


______________________



They cannot keep quiet about the severe neurological injuries and the fact that the chemicals in the vaccine concoction cross the blood/brain barrier and that causes a whole lot more than a headache for a few hours. It permanently cripples and disables people and kills some people. True statistics do not exist.

Large numbers of elderly patients in nursing homes are being killed.

Almost every adult person in the USA has experienced side effects from one or more prescription medicines. If you have ever had allergic side effects from having a Prestone anti-freeze cocktail, you had better opt out of these PEG, polyethylene glycol vaccines.

There are several propaganda video channels on YouTube of this same propaganda nature to minimize the seriousness of the injuries caused by these vaccines.

Here is another example

https://www.youtube.com/watch?v=HxAVuAkJyZI

Why did patients die in Norway after Pfizer vaccine administration? #COVID​-19
320,953 views
•Jan 18, 2021
3.2K
470
Share
Save
Dr Pal
31K subscribers

______________

Dr. Pal should be no pal of yours. He incredibly said that the reason they gave the vaccine to elderly frail patients in nursing homes in Norway is because those patients were going to die anyway in about 5 or 6 months at most and the vaccine was to prevent them from dying even sooner.

What subtle evil crafted utter deception!

___________

Pfizer and Moderna are not fully disclosing exactly what ingredients are in the vaccine and have not disclosed the rushed push to market and skipping testing on animals. These mRNA vaccines are a whole new kind of "vaccine" and choosing to rush the approval procedures based solely on the fear and panic they created and kept deliberately hyped up certainly qualifies as CRIMES AGAINST HUMANITY in the thinking of more and more of the public.

Dachsie
4th February 2021, 02:58 PM
"WuFlu Bat Stew News for You" > principia-scientific.org

https://principia-scientific.com/wuflu-bat-stew-news-for-you/

WuFlu Bat Stew News for You
(https://principia-scientific.com/wuflu-bat-stew-news-for-you/)
Published on August 3, 2020

Written by Joseph A Olson PE

https://i0.wp.com/principia-scientific.com/wp-content/uploads/2020/08/11.jpg?resize=550%2C290&ssl=1

elcome Bat Fans, as promised, same bat-time, same bat-channel, the latest news on the Bat Stew hysteria, but WARNING, this information could be disturbing to child-like perceptions of our fake reality, adult guidance is recommended.

You’ve been a faithful subject, believed every deceptive official narrative. You have quietly OBEYED and you have loyally CONSUMED. But at some point, the preponderance of evidence becomes overwhelming. Now this week’s, shocking news.

HYDROXYCHLOROQUINE DECALCIFIES THE PINEAL GLAND

Rumors of this powerful medical fact began to be posted on line, and if there is one Truth on this current quarantined planet, it is that the plutocrat directed Mid Stream Media and the Silicon Valley, soy boy digital warlords will rabbit-hole all Truth, as fast as they can. You never wanted to fall down the Alice in Wonderland rabbit hole, but as they keep telling us, “We Are All in This Together”

First some biology, the Pineal Gland is that almond sized lump at the base of your brain that monitors and regulates your endocrine system, your body’s hormone levels and your circadian rhythms, which control your sleep cycle. Disrupt this elegant biological system and you make life a little less joyous. See here: EndocrineWeb.com [1]

So how do humans get a calcified gland, you ask. Well, certain Halogens, when ingested, displace Iodine, and these toxic elements have an affinity for the element Calcium. If Periodic Tables are not your thing, then this article will explain the role of these three elements in cancer. See here: BeyondThyroidCancer.com [2]

For those who have followed my research over the last six months, the next information is self evident (for new readers see the predicate listed in the bootnotes). There has been a very nefarious group of plutocrats in charge of a false reality for centuries (see the documentaries below, beginning with “All Wars Are Bankers Wars”).

Unchallenged plutocrat control of our planet can only have a limited number of players. For each of the 300 or so “top” plutocrats, there can only be so many generals, so many lieutenants, and so many serfs. For over a century, these plutocrats have stated that the Earth’s population must be reduced to 500,000 humans; genocide is a necessity.

Since we are so many, and they are so few, their success depended on unnoticed, asymmetrical warfare on all fronts, chemical, biological and actual false flag staged warfare. This sedition of civilization is the British extension of the Roman model, a master/slave organization imposed on the British for 400 years, fractionalized and imposed on Europe for a thousand years and culminated in dominance of the British empire after Waterloo.

Chlorine was discovered by a Swedish scientist in 1774, and by mid19th century was recognized as a disinfectant. First use in water treatment was as a point of use sterilant in the UK in the 1890s. It was applied in large scale to the water supply of the Lincoln township, in 1905 with satisfactory results. By 1908 the first chlorinated water systems were operational in America.

Meanwhile, Paris had discovered that Ozone, O3 was another method of water purification with fewer harmful side effects. Today there are over two thousand major cities that use Ozone purification. Nazi death camps used Fluoride to sedate their prisoners. Following World War Two, our death camp overlords demanded adding this Halogen to our drinking supply, albeit in lower dosage of 1 PPM.

The American Dental Association and the American Medical Associations are both captive propaganda outlets for the plutocrats. After overwhelming evidence of the harmful effects of fluoridated water, the HHS ordered reduction from 1.0 to 0.7 PPMin 2015 (see “ADA Applauds HHS Reduction in Fluoride” at ADA.com). Clandestine poisoning always involves long term, low dosage, ask Napoleon.

Fluoride calcification of the Thyroid and Pineal glands induce a number of medical symptoms that the AMA quacks can prescribe a lifetime of tinctures to disguise, but never cure. But if the medical mafia approved level of Fluoride poisoning was reduced, then how would the injurious dosage be maintained, enter the FDA.

The FDA had approved a number of sterilization methods for the food chain, safest among these was Nitrogen baths. By flooding food processing chambers with inert Nitrogen, all biological agents were exterminated. Other safe methods used the above mentioned Ozone: ionization with UV lights and the questionable irradiation, mainly used for long term survival food supplies.

After the HHS ruling, the FDA banned all alternatives and demanded that all beans and nuts must be sterilized using Fluoride, meaning your coffee is now a poison delivery system. Since the “Tinfoil Avoidance” readers have already stopped reading these Truths, we can now explain more of the sedition organization system.

The great Patriot, Captain Field McConnell was among the first to mention SERCO, the largest company that you never heard of, and their crime partner, the SES, Senior Executive Service. The Aim4Truth website has an Excel searchable directory of the Plum Book of SES members. With over 10,000 under qualified, over paid saboteurs. This group includes every bureaucratic puppet in the news today, along with many congress critters and judges.

We will someday marvel at the vast organizational level of this genocide program, but to do so, we must recognize additional preplanning. Medical doctors who have prescribed safe, effective HCQ as preventative and cure have been censored on social media and threatened by their state licensing boards. Thanks to Dr Judy Mikovits, PhD at PlagueTheBook.com for disclosing this additional connection.

The Bayh-Dole Act, 35USC/200~212, passed in 1980, transferred ownership of TAXPAYER FUNDED scientific research patents from the US Treasury to the bureaucrats in charge of the research teams. HIAID leader Fauci, along with the heads of CDC, FDA, NIH and others, therefore benefit directly from every tincture they approve, or worse, impose by medical mafia fiat.

Recognizing the toxic viral load in every vaccine, the congress critters passed the National Childhood Vaccine Injury Act (NCVIA) in 1986, making the TAXPAYER responsible for every vaccine injury. So we have a regulatory agency, profiting from an industry that has ZERO obligation to make a safe, effective product. To the contrary, this medical mafia has every motive to INTENTIONALLY make defective products, if they can also prescribe palpatives to suppress the side effect “symptom”.

If you mix science and politics, what you get is POLITICS. Sadly, we cannot discuss Carbon climate forcing without being labeled anti-science by those who are in fact illiterate on Thermodynamics and Radiation Heat Transfer Physics. The same applies to a vast array of orthodox science myths.

You might be upset at all this discord, and like Rodney King say, “Can’t we all just get along” but the ruling Divide and Conquer overlords uses this wedge issue as well. Nothing is a coincidence. Just when the WuFlu hysteria was waning, another in a series of gentle giant racial incidents erupted, this time in Minneapolis.

We have reached the Apocalypse threshold, either we stand up and fight now, or we are condemned to slavery and early death. If we, in mass refuse to wear a choking mask, if we refuse to have medieval social distancing from our fellow human beings, if we refuse mandatory voodoo vaccination, then we can defeat this evil phantom.

“The sheep spend their whole life in fear of the wolf, only to be eaten by the shepherd”

We have been repeatedly sheared by the shepherd, but now he wants to skin and eat us, as part of his dystopian half-billion people planet plan. We need YOU to stop being a sheep, become a SHEEPDOG and help us overcome the wolves and their wolf pack leading sheepherders.

References:

[1] https://EndocrineWeb.com/endocrine/overview-pineal-gland

[2] https://BeyondThyroidCancer.com/Fluorine-Chlorine-Bromine

Bootnotes:

“All Wars Are Bankers Wars” by Michael Rivero at > WhatReallyHappened.com

“Divide and Conquer, the Left/Right Fraud” at > CorbettReport.com

“The World War One Conspiracy” at > CorbettReport

NCVIA information by Del Bigtree at > theHighWire.com

Posted at principia-scientific.org by this author:

“Pandemics Are PERSONAL”

“Remember the A La Mode Review”

“Last Waltz Across Texas”

“WuFlu@WarpSpeed”

“Right To Try Voodoo”

About the author: Joseph A Olson PE. Joe co-authored ‘Slaying the Sky Dragon – Death of the Greenhouse Gas Theory’ the world’s first full-volume debunk of the greenhouse gas theory and is co-founder of Principia Scientific International. Retired Texan engineer and impassioned science writer, Joe is a respected innovative thinker with over 100 major civil engineering and climate-related articles to his name.

______________

Mr. Olsen was also the guest today in James Fetzer's Revolution Radio show of Feb. 4, 2021.

The Power Hour/The Raw Deal Simulcast (3 February 2021) with Joe Olson, P.E.

https://www.bitchute.com/video/JwO0uznkQAt5/

irst published at 19:46 UTC on February 4th, 2021.

channel image

Jim Fetzer

Jim Fetzer

3987 subscribers

We began with proof that the CDC has manipulated the COVID-19 death count by some 1,600% to manufacture a pandemic, followed by proof that then-President Trump did not commit incitement or lead an insurrection, where the objective of this sham impeachment is to attempt to have him precluded from running again, where he would clean their clocks just as he did in 2020. Rep. Marjorie Taylor Greene (R-GA) has been making waves in D.C. by filing impeachment against Joe Biden and alleging (accurately) that Sandy Hook and Parkland were staged events, not mass school shootings. I applaud her. [NOTE: The recording is choppy.]

Dachsie
4th February 2021, 04:26 PM
https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-february-04-2021

TruNews Headlines with Kerry Kinsey - February 04, 2021

A Virginia woman dies within hours of getting the Covid vaccine.

Tony Robbins goes off on coronavirus lockdowns and inflated death counts.

Catherine Austin Fitts exposes the connections between Big Tech and the feds to control the world in the documentary “Planet Lockdown.” She says, “A Virus is the perfect invisible enemy; if you can use fear, people will need the government to protect them from the invisible enemy.”

A Florida hospital worker says, "She was told to “prepare for a covid crisis” that’s going to start next week. On “Corona Crazy” the CDC says no cheering during the Super Bowl.
Content Contributed By — TruNews Team

___________________________

https://www.wtkr.com/news/gloucester-resident-dies-within-hours-of-receiving-pfizer-vaccine

Gloucester resident dies within hours of receiving Pfizer vaccine (1st dose of vaccine)

embedded video

GLOUCESTER, Va. - "She could bellow from the bottom of her soul," said Lisa Jones.

58-year-old Gloucester resident Drene Keyes was a gifted singer, a mother and grandmother of six.

"She was such a loving and generous person," said Jones.

Unexpectedly, Lisa lost her mother on Saturday within a couple of hours after Keyes received the Pfizer vaccine in Warsaw.

"Right before she left, I was helping her put her shoes on," she said.

Keyes had diabetes, sleep apnea and was obese. Her job made her eligible for the first dose. So, on Saturday, Keyes got the Pfizer vaccine and spent 15 minutes in the mandatory observation period.

Recent Stories from wtkr.com

The coworker she was with said she was trying to get in the car and said, "Something is not right. Something's not right."

Dachsie
5th February 2021, 06:15 AM
https://rumble.com/vdjk7d-lin-wood-fireside-chat-11-is-lin-insane-doctors-explain-whats-inside-the-co.html?mref=6zof&mc=dgip3&utm_source=newsletter&utm_medium=email&utm_campaign=Thrivetime+Show%3A+Business+School+wi thout+the+BS&ep=1

1:39:56 video runtime

Lin Wood on the show until 53:29

https://cdn1.telesco.pe/file/DeS0heO2Fec77AnGNnfA3j_pEkU6Grw0y1rugjknVr0KYX5Kco MNUgCRm41cnWRdRBvyQ2US3v8aYIsGUYCCJoEI4BYZhJNNB4L_ MPHJZUhuxJwknf1J2Ti5HyF7zWKTcjJ_0V_9-NViTviUYF69RkDkcXzcaocsHXltYImxBSqwJMrAOyunDGaVnMc Cew6GJqg47Ok96RT2E-WEYtTlzy7MSaDaSQ_vpwdRnDzn734AqmjIcROFkww884GvDoOK YxLJXnrPslMOxraN9l7wyor5Wxvo8BGP2LZr3dQ8-C3KZhqFk-OPO6DfDBzO2abVqU_xfiT3PKTqOkLKXq6snw.jpg

Remainder of show are three doctors speaking about the fake virus pandemic and the vaccine.

______________________

Lin Wood's Telegram account is

https://t.me/s/linwoodspeakstruth

Rumble — Attorney Lin Wood joins to answer questions about his sanity, persecution and personal attacks against him then Dr. Sherry Tenny Penny, [Sherri Tenpenny, osteopath], medical doctor Robb Marsh, and medical doctor Jim Meehan warn that YOU SHOULD NOT TAKE THE COVID-19 vaccine (GENE MODIFICATION TECHNOLOGY).
519 COMMENTS

_______

Dachsie comments: This show link could also be appropriate for other threads, such as
Pizzagate
Vote fraud and election
Religion - Philosophy
Coinstitution
Population Control Agenda
Communist takeover of USA
____________

Interest comment by Lin Wood stating there were "birthing stations" at Epstein Island and other Epstein properties. DNA related activities on humans. TruNews did extensive reporting on this matter in relation to New Mexico Epstein property.

PatColo
5th February 2021, 01:36 PM
31s clip inside: https://twitter.com/MaryamHenein/status/1289959827540647937


Maryam Henein/ #Shadowbanned (aka BeeLady) Sassy
(https://twitter.com/MaryamHenein)DIGG| #Fauci (https://twitter.com/hashtag/Fauci?src=hashtag_click), #Foreskin (https://twitter.com/hashtag/Foreskin?src=hashtag_click), #Clintons (https://twitter.com/hashtag/Clintons?src=hashtag_click),#BIllGates (https://twitter.com/hashtag/BIllGates?src=hashtag_click)
Who Knew? #FauciTheFraud (https://twitter.com/hashtag/FauciTheFraud?src=hashtag_click) is also an expert on circumcision!
In '08, he claimed it lowers risk of infection against #HIV (https://twitter.com/hashtag/HIV?src=hashtag_click).
But greedy docs promote circumcision for purely financial reasons. Targeting #Blacklivesmatter (https://twitter.com/hashtag/Blacklivesmatter?src=hashtag_click)

Dachsie
5th February 2021, 02:51 PM
https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-february-05-2021

12:27 video runtime


TruNews Headlines with Kerry Kinsey - February 05, 2021 (https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-february-05-2021)

A news survey says 51 percent of Americans would refuse or delay the Covid vaccine. Del Bigtree says that’s because of all of the side effects associated with it, including deaths.

The Vaccine Adverse Event Recording System reports 329 deaths from the vaccine from two weeks ago, but Dr. Rashid Buttar says only 1% of people reported their events to the VAERS system.

David Knight says the mRNA vaccine is modifying our DNA, and how would you manufacture a Pandemic?

We show you four ways it looks like they’re pulling off a plandemic. On “Corona Crazy,” Tucker hammers Shepard Smith’s story of maskless Floridians at a supermarket, and on “Commie Crackdown,” TruNews Headlines gets shut down by YouTube, forever!
Content Contributed By — TruNews Team

Dachsie
6th February 2021, 08:23 AM
https://img.ifunny.co/images/a42a210e138f26907514acb3f870c6838d8f8f0dd7ade86640 05f365213ee999_1.jpg

https://img.ifunny.co/images/a42a210e138f26907514acb3f870c6838d8f8f0dd7ade86640 05f365213ee999_1.jpg

Dachsie
6th February 2021, 08:25 AM
https://www.youtube.com/watch?v=qYNMP1l5mdw

live stream protest Covid restrictions Germany Feb 6 2021

Dachsie
6th February 2021, 11:48 AM
Another disgusting disinfo propaganda video regarding a vaccine death.

Shame on Dr. Klausner.


https://www.youtube.com/watch?v=CeMLyHuaPxc

...https://www.youtube.com/watch?v=CeMLyHuaPxc...

Woman Warns She Saw Grandfather's Aid Die After COVID Vaccine

Woman Warns She Saw Grandfather's Aid Die After COVID Vaccine
30,709 views
•Jan 24, 2021
496
43
Share
Save
CBS Sacramento
63.2K subscribers
Despite the cause of death being investigated following a person's death hours after receiving the vaccine, there are questions from the community on the safety of the shot. An Auburn woman says she witnessed the tragedy first hand.

Dachsie
6th February 2021, 12:03 PM
Another disgusting disinfo propaganda video regarding a vaccine death.

Shame on Dr. Klausner.


https://www.youtube.com/watch?v=CeMLyHuaPxc

...https://www.youtube.com/watch?v=CeMLyHuaPxc...

Woman Warns She Saw Grandfather's Aid Die After COVID Vaccine

Woman Warns She Saw Grandfather's Aid Die After COVID Vaccine
30,709 views
•Jan 24, 2021
496
43
Share
Save
________________




This would be in Auburn California in Placer County. Name of deceased never given. I know I posted this one before in Placer county.

Woman Warns She Saw Grandfather's Aid Die After COVID Vaccine
30,709 views
•Jan 24, 2021


No Link Found Yet: Auburn Woman Warns She Saw Grandfather’s Aid Die After COVID Vaccine


Aids who work in nursing homes, and home health aids who work for agencies that provide home health care to patients in their homes are REQUIRING these aids to get the Covid 19 vacination. I guess but am not sure this is a state law requirement varying by each state's laws.

Show me the law!

Dachsie
7th February 2021, 03:40 PM
Dr. Sherri Tenpenny Explains How the Depopulation COVID Vaccines Will Start Working in 3-6 Months (https://www.bitchute.com/video/nCJgZLroYJiK/)

1:03:06 video runtime

https://static-3.bitchute.com/live/cover_images/Rbtrop3rRlZl/nCJgZLroYJiK_640x360.jpg

Dr. Sherri Tenpenny Explains How the Depopulation COVID Vaccines Will Start Working in 3-6 Months

https://www.bitchute.com/video/nCJgZLroYJiK/

First published at 21:43 UTC on February 7th, 2021.

channel image

Jim Fetzer

Jim Fetzer

4102 subscribers

REQUIRED VIEWING! Dr. Sherri Tenpenny gives VERY important information! Hyper-immune response in test animals for previous attempts at coronavirus vaccines, like SARS and MERS, has been a persistent problem. All is well for awhile, until the animals are exposed to the wild mutated virus. Dr. Tenpenny and other scientists have forecast that millions may die, and it will be blamed on a new strain of COVID, making an argument for even more deadly vaccines. See: "The Coming Genocide of Adverse COVID Vax Reactions, and Who to Blame for It" https://coronanews123.wordpress.com/2021/01/25/the-coming-genocide-of-adverse-covid-vax-reactions-and-who-to-blame-for-it/

Dachsie
7th February 2021, 04:07 PM
https://vaxxter.com/

https://vaxxter.com/category/drt_blog/


Coronavirus, COVID19, Dr. Tenpenny's Blog 12/27/2020
Coronavirus Pt. 6: The COVID Vaccines – part 1 – UPDATED
by Dr. Sherri Tenpenny, DO, AOBNMM, ABHIM Part 2 here In December 2020, the first vaccines for coronavirus disease were granted an EUA – Emergency Use Authorization – by the Food and Drug Administration (FDA)…



COVID19, Dr. Tenpenny's Blog, Hydroxychloroquine (HCQ), Vaccine Politics 08/03/2020
Coronavirus Pt 5: Hydroxychloroquine and The Ohio Boomerang
by Dr. Sherri Tenpenny, DO, AOBNMM, ABIHM On Monday, July 27, a group of physicians called The Frontline Doctors met on the steps of the Supreme Court of the United States in Washington DC for…



COVID19, Dr. Tenpenny's Blog, Masks 07/16/2020
Coronavirus Pt 4: Masks Don’t Protect
by Dr. Sherri Tenpenny, DO, AOBNMM, ABIHM Over the last several months, the battle lines regarding COVID19 have been drawn around the concept of masking. Wearing a mask has become a symbol of staying together,…



Dr. Tenpenny's Blog, Pandemics 05/18/2020
Coronavirus Pt3 – Testing: What are we doing? What does it mean?
by Dr. Sherri Tenpenny, DO, AOBNMM, ABIHM* In 1965, scientists identified the first human coronavirus; it was associated with the common cold. The Coronavirus family, named for their crown-like appearance, currently includes 36 viruses. Within…


COVID19, Dr. Tenpenny's Blog, HC Politics - General, Legislation, Pandemics 03/30/2020
Coronavirus Pt2 – The Dangerous 2005 PREP Act
Until recently, the concept of mandatory and mass vaccination has been only a worrisome possibility.



https://vaxxter.com/category/drt_blog/page/2/

Coronavirus, COVID19, Dr. Tenpenny's Blog, Pandemics 03/24/2020
Coronavirus Pt 1: How Soon We Forget – Same Playbook, Different Virus
I wrote this article to give you some perspective. I couldn’t help but think when this COVID19 blitz started, “How soon we forget…”

Dachsie
7th February 2021, 05:07 PM
A couple of things about the Dr. Tenpenny interview by Reinette Senum.

Reinette Senum was elected mayor of Nevada City, California and served for a short while but then decided to not continuing serving as mayor.

https://yubanet.com/regional/reinette-senum-resigns-from-nevada-citys-city-council/

It is interesting to read the letter she published regarding her decision to resign the mayoral position but even more interesting to read the responses of her fellow Nevada City residents. Her resignation appears directly related to Governor Newsomes increasing totalitarian dictates regarding "Covid" as well as related to the mindset of the apparently mind controlled zombie-like citizens who voted for her but now attack her.


12 replies on “Reinette Senum resigns from Nevada City’s city council”

Kathleen says:
July 8, 2020 at 11:50 pm

And where is your compassion for people like my husband who is recovering from a bone marrow transplant after surviving leukemia at 62? He and I are completely isolated in our home because of those who do not honor the science of this illness and the protections masks have been proven to provide. This illness will kill him. Period. Also, open businesses cannot survive if their employees get sick and half of their customers cannot patronize them because they and/or their customers do not follow science based practices that protect all of us.
Niel Locke says:
July 9, 2020 at 6:21 am

Kathleen,
You are absolutely correct concerning not only yourself and your husband but all others who do not want to become ill by using the effective, proven worldwide protocols.
Michelle Lewis says:
July 9, 2020 at 8:31 am

Yes, Reinette, you’ve implemented some creative programs.

But the damage you’ve done, putting vulnerable people’s lives at risk, certainly outweighs the good.

You’re open to unproven scientific theories, yet you reject the overwhelming agreement of the medical community on the efficacy of wearing a mask to prevent disease transmission.

I hope you’ve enjoyed your 15 minutes of fame.
Omar Otis says:
July 9, 2020 at 8:32 am

Good riddance!!!
Hopefully her supporters will “resign” too.
eric holtrop, MD says:
July 9, 2020 at 12:57 pm

While standing under a bridge you would never ask some pedestrian for advice on which nut or bolt could be removed; you would ask an engineer. Searching for other opinions would be nuts.

When attempting to get opinions on healthcare you would ask a Physician. Searching for other options would be ….. nuts!

We spend 12 years in college, pass countless tests and board examinations and work 50-100 hours a week for decades taking care of patients. Listen to your Doctor, they have the correct/evidence based opinion for you. If you dont like the opinion that is fine, but dont spout off non sensical, non evidence based claims just because you are not adult enough to follow a guideline layed down by Physicians.
Evans Phelps says:
July 9, 2020 at 1:42 pm

Thank you for resigning. This saves the good citizens of Nevada City spending a lot of time and money getting you recalled. Now you can rail against the police, complain about high speed internet and smart meters, rant about our governor and the advise of medical experts, continue calling citizens in town bad names with insulting adjectives, and believe in conspiracy theories that you post on social media without insinuating you speak for all of us as our elected official. Thank you for at least having the good sense to realize your time is up.
Ray Shipley says:
July 9, 2020 at 2:26 pm

Obviously the lady has a problem with Governor Newsom, who has been handling the enormous stress he must be under quite admirably. I wonder what party this mask denying, Ex-City Counselwoman affiliates with? Shameful and willfully ignorant! Bye, bye!!
Jim Pyacek says:
July 9, 2020 at 4:58 pm

“The economic, and psychological and emotional damage we are enduring completely outweighs any of the benefits.”
Really? Even when the “benefits” to adhering to the mask-wearing guidelines are the reduced risk of getting sick and ending up with decreased organ function, or dying? Or causing someone else to go through that? This is not about any one individual. It’s about all of us.
Barry Pruett says:
July 9, 2020 at 5:14 pm

While Reinette and I have differing views on some subjects and similar views on others, I have always appreciated her positive attitude towards debate, her willingness to happily listen to others viewpoints which may differ from hers, and her general positive demeanor. Sadly, such traits are often times lacking in our society. Good luck Reinette.
Megan Graham says:
July 10, 2020 at 8:59 am

Good riddance. No one complains when adhering to other health mandates like “No shirt, No Shoes, No Service”, “Smoking 20ft away from a building” or “Employees washing their hands after using the bathroom” and yet a simple mask has caused so much controversy when it’s meant to save lives and stop the spread of the virus. If the virus doesn’t have a human host to go to it will die out but so many people have made this political or about the constitution when it’s about the safety of our community and our town being able to stay open and not endure another shutdown. If everyone did their part, we could move past this without as many lives and businesses lost and come together as a community instead of this state of division we are in.
Michael Murphy says:
July 10, 2020 at 6:58 pm

Reinette sounds more like a Trump-zombie every day – can’t helpbut woinder if she also thinks climate-change is a hoax, or not worth the economic cost to try to slow it down… don’t let the door hit you on the way out…
Margie Determan says:
July 10, 2020 at 11:25 pm

I am hopeful that as part of the acceptance of Ms. Senum’s resignation from the Nevada City City Council, the City Attorney makes it abundantly clear to her that she may not make any representation that she has any role as a leader in the community as she spouts off her flatly incorrect views on the use of face coverings to combat COVID 19.
There can be no confusion going forward. She does not speak for Nevada City, it’s leadership, its business community, or most of its citizens, and she should be legally enjoined from doing so.

Comments are closed.

_____________________________

To me everyone who has not become completely brain washed ahd brain dead can see how mesmerized and full of hate they are. None of them express the slightest concern that the Covid policies of the California oovernor Newson are destroying lives, incomes and destroying the whole state of California.

These mentally ill people are the kind of people who voted for Newsom and Biden and they love Chinese communism and all the wonderful things it has already done to their state.

Beware of these people and shun them in every situation as they are destructive and crazy and call evil good.

Dachsie
7th February 2021, 05:15 PM
Here iis the free courses on vaccines mesourse mentioned by Dr. Tenpenny in the interview.

https://www.vaccineu.com/?r_done=1



Courses4Mastery Presents:

VaccineU

Advanced Vaccine Courses

Deepen your knowledge on specific vaccines and specific vaccine topics. Learn at your own pace.



Enroll once; have life-time access to study the materials.

Return and review as often as you'd like.

NEW COVID SERIES IS

FREE FOR A LIMITED TIME

CLICK HERE!




Our courses on vaccines include individual vaccines, vaccine ingredients vaccine politics and more.



Our courses on language training and overall health are designed to be APPLICABLE in every area of your life.



You will gain the CONFIDENCE you seek to make correct choices for you and your family.

Courses4Mastery was designed to bring balance to the topic of vaccines:

Our Twice/yr Boot Camp Course
Our Research Library
Our VaccineU - advanced modules on on individual vaccines.

You do NOT need to go through the Boot Camp to access and study the individual courses available at VaccineU.

This information is designed specifically for you - as a parent, a physician, a healthcare worker, a community leader and a political activist.

We're so glad you're here.

ziero0
9th February 2021, 06:46 AM
Vacco = latin for cow

Vaccine comes from the cow pox solution for smallpox.

Now every time you get stuck with an injection the cow gets sucked into the act.

Vaccines are for those who care to be one with the cow.

PatColo
12th February 2021, 04:44 PM
A couple of things about the Dr. Tenpenny interview by Reinette Senum.

I didn't watch that Tenpenny interview but I gather today's trunews headlines cover the main takeaway,



TruNews Headlines with Kerry Kinsey - February 12, 2021
(https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-february-12-2021)
Dr. Sherri Tenpenny says, "'If you take the vaccine; coronavirus will eventually show up and it's going to start killing people." She says, "Some people will die from the vaccine directly; others will get autoimmune diseases 42 days to a year out."

Alex Berenson says, "A 37-year-old doctor in Memphis died Monday of an immune response after receiving the Covid vaccine." It now appears health authorities want to whitewash the death as somehow being related to the virus rather than the vaccine- EVEN THOUGH HE NEVER TESTED POSITIVE FOR COVID.'

David Knight says India wants more Pfizer testing of its vaccine, so Pfizer leaves the country. Dr. Carrie Madej says the signature of God is found in our DNA, maybe that's why she's so against what many are calling gene therapy.

On 'Corona Crazy,' a Texas mom tackles a man accused of peeking in her daughter's bedroom.

https://www.trunews.com/stream/trunews-headlines-with-kerry-kinsey-february-12-2021

osoab
12th February 2021, 07:40 PM
Vacco = latin for cow

Vaccine comes from the cow pox solution for smallpox.

Now every time you get stuck with an injection the cow gets sucked into the act.

Vaccines are for those who care to be one with the cow.

Vishnu approved?

woodman
12th February 2021, 07:54 PM
Vacco = latin for cow

Vaccine comes from the cow pox solution for smallpox.

Now every time you get stuck with an injection the cow gets sucked into the act.

Vaccines are for those who care to be one with the cow.
What about the milkmaids? Maybe milking the maids will protect you? I read somewhere, once upon a time, that in Egypt, a practice was once done where a small scratch upon the arm was rubbed with the pus from a smallpox pustule and the recipient would usually be innoculated against a severe reaction from smallpox.

osoab
12th February 2021, 07:59 PM
Get your stockings out ladies.

You might get premium prices in Japan.

CDC Recommends Putting Hosiery over Your Face along with a Mask (https://www.nationalreview.com/corner/cdc-recommends-putting-hosiery-over-your-face-along-with-a-mask/)

PatColo
13th February 2021, 06:40 PM
2 new Dr. Carrie interviews today; I'm not familiar with either host:

45m: EP. 34 DR. CARRIE MADEJ ON WHY VACCINES ARE A THREAT TO HUMANITY & CAUSE INFERTILITY, QUI BONO (https://www.bitchute.com/video/Jalh6zdIeJES/)

w Jeff Witzeman, 30m: https://www.instagram.com/tv/CLP1_UbJ7Ui/?igshid=19wh07g63rsq9

PatColo
16th February 2021, 03:37 PM
Seattle woman, 90, walks 6 miles through snow barefoot for vaccine
(https://abcnews.go.com/Health/wireStory/seattle-woman-90-walks-miles-snow-vaccine-75927325)
A rare winter storm that dumped a foot of snow on Seattle couldn’t keep a 90-year-old woman from making her first COVID-19 bioweapon "vaccine" >:D appointment

ByThe Associated Press
February 16, 2021, 1:42 PM
• 2 min read
https://s.abcnews.com/images/Health/WireAP_baefda9abb374a609c542bc1dc124c63_16x9_384.j pg

SEATTLE -- A rare winter storm that dumped a foot of snow on Seattle couldn’t keep a 90-year-old woman from her first appointment for the coronavirus vaccine.

The Seattle Times reports that Fran Goldman walked six miles round trip to get her shot.

“I have been calling to get an appointment anywhere, every morning, every afternoon and often I’ve been online at night,” Goldman said.

moar https://abcnews.go.com/Health/wireStory/seattle-woman-90-walks-miles-snow-vaccine-75927325

EE_
16th February 2021, 04:25 PM
Seattle woman, 90, walks 6 miles through snow barefoot for vaccine
(https://abcnews.go.com/Health/wireStory/seattle-woman-90-walks-miles-snow-vaccine-75927325)
A rare winter storm that dumped a foot of snow on Seattle couldn’t keep a 90-year-old woman from making her first COVID-19 bioweapon "vaccine" >:D appointment

ByThe Associated Press
February 16, 2021, 1:42 PM
• 2 min read
https://s.abcnews.com/images/Health/WireAP_baefda9abb374a609c542bc1dc124c63_16x9_384.j pg

SEATTLE -- A rare winter storm that dumped a foot of snow on Seattle couldn’t keep a 90-year-old woman from her first appointment for the coronavirus vaccine.

The Seattle Times reports that Fran Goldman walked six miles round trip to get her shot.

“I have been calling to get an appointment anywhere, every morning, every afternoon and often I’ve been online at night,” Goldman said.

moar https://abcnews.go.com/Health/wireStory/seattle-woman-90-walks-miles-snow-vaccine-75927325

I wonder how much someone could get auctioning off their covid shot, if they could do that? This lady probably would have paid $1,000

PatColo
16th February 2021, 05:04 PM
I wonder how much someone could get auctioning off their covid shot, if they could do that? This lady probably would have paid $1,000

that's actually a great biz idea! :D

so after I connect with my mark thru ebay/craigslist/wherever; we meet, get muh cash x 2 as collateral for my ID's return; I give them my ID & appointment time/place. They show up w my ID (irrelevant if they're not 53yo Male 6-3 Bln/Blu -- they can be 65yo 5' tall woman (ideally joosh), wotever, the jabbers aren't particular if ID doesn't quite match up like that, they just wanna jab jab jab)... then jabbers check ME off as having properly got the Kermit-bioweapon!!

diabolically brilliant! >:D

PatColo
16th February 2021, 10:55 PM
Facebook CEO Mark Zuckerberg Takes ‘Anti-Vax’ Stance in Violation of His Own Platform's New Policy

177,527 views
•Feb 16, 2021
Project Veritas

5m https://www.youtube.com/watch?v=oXWREk7MVqQ


https://www.youtube.com/watch?v=oXWREk7MVqQ

PatColo
16th February 2021, 10:58 PM
tonight's Rense Hr 2

Download (https://ln2.sync.com/dl/6f00b7750/t5h622ms-38k98u5r-u6w3ct2s-87858va9) Hour 2 - Dr. Erica Khan - Nanoscientist MIT Grad Newst SHOCKING Data On The Pfizer-Moderna mRNA (Death) Injections - Why Countries Are Lining Up (https://anti-empire.com/amp/countries-are-lining-up-for-russias-non-mrna-vaccine-that-is-as-effective-or-ineffective-as-western-counterparts/) for Russia's Non-mRNA Vaccine - Hint...It's Not Killing and Maiming People

monty
25th February 2021, 10:44 AM
German Lawyer Reiner Fuellmich plans to prosecute those who perpetrated the Great Covid Scam

Lawyers Promise ‘Nurember Trials’ Against All Behind COVID Scam
(https://principia-scientific.com/lawyers-promise-nurember-trials-against-all-behind-covid-scam/)
Published on February 24, 2021
Written by Jean-Michel Grau

https://i0.wp.com/principia-scientific.com/wp-content/uploads/2021/02/dds-1.jpg?resize=550%2C308&ssl=1

Right now, a second Nuremberg tribunal that is in preparation, with a class action lawsuit being set up under the aegis of thousands of lawyers worldwide behind the American-German lawyer Reiner Fuellmich, who is prosecuting those responsible for the Covid-19 scandal manipulated by the Davos Forum.

In this respect, it is worth recalling that Reiner Fuellmich is the lawyer who succeeded in condemning the automobile giant Volkswagen in the case of the tampered catalytic converters. And it is this same lawyer who succeeded in condemning Deutsche Bank as a criminal enterprise.

According to Reiner Fuellmich, all the frauds committed by German companies are derisory compared to the damage that the Covid-19 crisis has caused and continues to cause. This Covid-19 crisis should be renamed the “Covid-19 Scandal” and all those responsible should be prosecuted for civil damages due to manipulations and falsified test protocols. Therefore, an international network of business lawyers will plead the biggest tort case of all time, the Covid-19 fraud scandal, which has meanwhile turned into the biggest crime against humanity ever committed.

A Covid-19 commission of enquiry has been set up on the initiative of a group of German lawyers with the aim of bringing an international class action lawsuit using Anglo-Saxon law.


Here is the summarized translation of the last communication of Dr. Fuellmich of 15/02/2021:



“The hearings of around 100 internationally renowned scientists, doctors, economists and lawyers, which have been conducted by the Berlin Commission of Inquiry into the Covid-19 affair since 10.07.2020, have in the meantime shown with a probability close to certainty that the Covid- 19 scandal was at no time a health issue. Rather, it was about solidifying the illegitimate power (illegitimate because it was obtained by criminal methods) of the corrupt “Davos clique” by transferring the wealth of the people to the members of the Davos clique, destroying, among other things, small and medium-sized enterprises in particular. Platforms such as Amazon, Google, Uber, etc. could thus appropriate their market share and wealth.”



Status of the Covid-19 Committee investigation

a. Covid-19 as a diversionary tactic by corporate and political “elites” in order to shift market share and wealth from small and medium enterprises to global platforms such as Amazon, Google, Uber, etc.

b. Contribution of the Audiovisual Tax to the reconstruction of a new media landscape that offers truly independent information




c. Making regional agricultural structures secure



d. Making a secure regional currency to prevent a new currency from coming “from above” to be allocated in the event of good behaviour.

e. Psychological considerations of the situation: how did it come about?
Actions for annulment of the approval of a vaccination, filed against the European Commission, trial in New York of the status of PCR tests, German trials, Canadian trials, Australian trials, Austrian trials, trials at the International Court of Justice and the European Court of Human Rights.

“We have seen what has been confirmed time and time again: the degree of danger posed by the virus is about the same as that of seasonal flu, regardless of whether it is a new virus (wholly or partially manufactured) or whether we are simply dealing with a flu renamed “Covid-19 pandemic”. In the meantime, Drosten’s PCR tests cannot even tell us anything about contagious infections. To make matters worse, the health and economic damage caused by anti-covid measures has been so devastating that we have to speak of a level of destruction that is historically unique. »

“The fact that health has never been an issue is particularly obvious, except that injections of genetically experimental substances disguised as “vaccinations” are now cauing serious damage, including fatal consequences, on a mass scale. The world population has been used as guinea pigs for these experimental gene injections both gradually and extremely rapidly. In order to plunge the population into panic, dangerous and harmful containment measures (even according to the WHO) of compulsory, unnecessary and dangerous mask-wearing and social distancing, unnecessary and counterproductive, were introduced. The population was thus “ready” for the injections.”


“In the meantime, more and more people, not just lawyers – and rightly so – are demanding, in addition to an immediate end to these murderous measures, a judicial review by a truly independent international tribunal on the model of the Nuremberg trials. An example of such a demand and a moving excerpt from a speech by the English doctor Dr. Vernon Coleman can be found at the following link:(



(Video gased by jewtubed)



http://youtu.be/T3DNV7v5i74






https://youtu.be/T3DNV7v5i74)



In addition, an interview with a whistleblower at a Berlin nursing home shows that out of 31 people vaccinated there, some of them by force, in the presence of Bundeswehr soldiers, and who tested negative before the vaccination, 8 have now died and 11 are subject to serious side effects.” (2020news.de/whistleblower-aus-berliner-altenheim-das-schreckliche-sterben-nach-der-impfung/ (http://2020news.de/whistleblower-aus-berliner-altenheim-das-schreckliche-sterben-nach-der-impfung/))
Extraordinary meeting of the Berlin Covid Committee Wednesday 17/02/2021

“In this context, an extraordinary meeting of the Berlin Covid Committee will take place on Wednesday 17.02.2021, live and with many guests participating via Zoom.
From 14:00 onwards, the state of play will be summarised. In addition, it will be discussed how the contributions from the Audiovisual Licence Fee Tax can be kept and used for the reconstruction of a new media landscape that truly serves freedom of expression, and how the contributions already paid for the senseless propaganda of the last 11 months can be recovered through a formal notice.

There will be contributions and discussions on how the food supply can be secured, in particular by strengthening regional agriculture; but also by creating regional currencies, if necessary with the return of the EU to the EEC, on how to ensure that the policy of the “Davos clique”, based on printing money out of nothing, can be stopped and a return to stable currencies can be achieved.

Above all, experts will explain how it could happen that we find ourselves in this blackmail situation unimaginable even a year ago.

In the second part of the session, starting at 7 p.m., world-renowned and high-level personalities will comment on the state of current international legal disputes, including the various collective actions, as summarised above. But it will also be discussed how the main perpetrators, in particular political perpetrators, of the crimes against humanity committed here can and must be held accountable under civil and criminal law in the framework of a new International Court of Justice to be established in accordance with the guidelines of the Nuremberg trials with international distribution.”

The link to the special session of the Covid Committee announced here will be available on 17.02.2021 via the Committee’s website (corona-ausschuss.de (http://corona-ausschuss.de/)).
Commentary :

To fully understand what is at stake with this new Nuremberg tribunal to judge the biggest tort case of all time, it is by pulling the thread of Dr. Drosten’s lie for falsifying the PCR testing protocol on behalf of the Davos clique, that everything will come to pass: the sponsors of the financial oligarchy, Klaus Schwab, the great architect of this gigantic hostage-taking, the politicians at the head of the EU, the armed arm of the execution of Drosten’s and WHO directives that led all Western governments yesterday to take the devastating decisions of containment, curfews, compulsory mask-wearing and social distancing, and today of lethal vaccines for the oldest among us.

“It is these truths that will bring down the masks of those responsible for the crimes committed. To the politicians who have had faith in these corrupt figures,” says Dr. Fuellmich, “the facts presented here are the lifeline that will help them to set the record straight and begin the much- needed scientific debate to avoid going down with these criminal charlatans.

Secondly, in the light of this latest communication by Dr Fuellmich, two proposals from the extraordinary meeting of the Covid Committee in Berlin are of particular interest:

Firstly, the way in which the food supply can be secured, which seems somewhat surreal given the current situation. According to Klaus Schwab’s planning for the Davos Forum, this is not the case. He has predicted a break in the food chain from the end of the second half of 2021 (nouveau-monde.ca/fr/la-quatrieme-phase-de-schwab/ (http://nouveau-monde.ca/fr/la-quatrieme-phase-de-schwab/)).

Secondly, the creation of regional currencies. There, it is clear that the Covid Committee of Berlin already anticipates the world stock market crash which is coming and which the financial oligarchy of the Davos Forum intends to take advantage of to set up the European digital currency in the expectation of a world currency to create a Chinese-style social credit on which the middle class of all the peoples ruined by the closure of their businesses, small and medium-sized industries and enterprises, cultural and tourist industries, sports facilities, etc. will become dependent.

These two aspects alone of the hostage-taking 2.0 of which the Western world has been a victim for almost a year should logically be sufficiently motivating to make us understand definitively that we are faced with a “populicide” that only asks to crush us if we remain inert, arms dangling without doing anything.

This is why each of us should do everything we can now to ensure that this international legal coalition can become operational as soon as possible. To this end, all those of us who wish to join the collective action of French lawyers to participate in this reconquest of our freedoms should already get in touch with the collective action by 21 February (francesoir.fr/opinions-entretiens/interview-me-virginie-de-araujo-recchia-avocate-au-barreau- (http://francesoir.fr/opinions-entretiens/interview-me-virginie-de-araujo-recchia-avocate-au-barreau-) de- paris). Our survival is at this price as well as the future of our children.


More at sciprint.blogspot.com (https://sciprint.blogspot.com/2021/02/the-greatest-nuremberg-of-all-time-is.html?m=1)

PatColo
25th February 2021, 11:45 AM
German Lawyer Reiner Fuellmich plans to prosecute those who perpetrated the Great Covid Scam

Lawyers Promise ‘Nurember Trials’ Against All Behind COVID Scam (https://principia-scientific.com/lawyers-promise-nurember-trials-against-all-behind-covid-scam/)


latest from @ReallyGraceful today - 1m 35s preview

I obviously cannot upload this video to YouTube
(https://www.youtube.com/watch?v=da37hG3lyg0&feature=youtu.be)
20,105 views
•Feb 25, 2021


https://www.youtube.com/watch?v=da37hG3lyg0&feature=youtu.be

full 8m vid:

This Lesson Of History CANNOT Be Forgotten
https://tv.gab.com/channel/reallygraceful/view/this-lesson-of-history-cannot-be-6037ad4c58afffa0caa24e15
or
https://www.bitchute.com/video/eyQWhl6NTU4K/
or
https://www.instagram.com/tv/CLt6lkhg8Rc/

from her twatt timeline:
https://twitter.com/reallygraceful/status/1364957492250349570

"The whole point is, we're supposed to buy the whole WWII story without question, and apparently it's been documented that they used vaccines for death by injection during that time, but now we're all just supposed to nod our heads and accept mandatory jabs and vaxx passports"

PatColo
25th February 2021, 01:39 PM
Pastor Chuck Baldwin:



The Covid PCR Test Is A Complete Fraud And Fauci Knew It All Along (https://chuckbaldwinlive.com/Articles/tabid/109/ID/4106/The-Covid-PCR-Test-Is-A-Complete-Fraud-And-Fauci-Knew-It-All-Along.aspx)



Published: Thursday, February 25, 2021









Download free computerized mp3 audio file of this column (https://chuckbaldwinlive.com/Portals/1/Content/Files/column-audio/2021_02_25_CB-Column_audio.mp3?ver=16iGU0u_NWDqD8Kbl8WQCw%3d%3d&timestamp=1614265887953)

Jon Rappoport (https://blog.nomorefakenews.com/) consistently provides some of the most detailed and incisive information regarding the fraudulent narrative of the coronavirus. His research is unassailable.


From his blog of February 22: (https://blog.nomorefakenews.com/2021/02/22/fauci-states-covid-pcr-test-has-fatal-flaw-confession/)






moar https://chuckbaldwinlive.com/Articles/tabid/109/ID/4106/The-Covid-PCR-Test-Is-A-Complete-Fraud-And-Fauci-Knew-It-All-Along.aspx

PatColo
26th February 2021, 02:54 AM
Under the Wire -
A conversation with Dr Carrie MadejNo Compulsory Vaccination
was live.February 24
1h
https://www.facebook.com/nocompulsoryvaccination/videos/424724922168721/

PatColo
26th February 2021, 03:35 AM
VIDEO: California School Board VP Says Reopening Schools Is ‘Very White Supremacist,’ ‘That’s What Slavery Is’ (https://nationalfile.com/video-california-school-board-vp-says-reopening-schools-is-very-white-supremacist-thats-what-slavery-is/)

Charda Bell-Fontenot did not appear to realize she was being recorded when she went on a racially-charged tirade during a school board meeting

by Gabriel Keane (https://nationalfile.com/author/gabenationalfile-com/)
February 25, 2021 (https://nationalfile.com/video-california-school-board-vp-says-reopening-schools-is-very-white-supremacist-thats-what-slavery-is/)

ImaCannin
26th February 2021, 03:24 PM
Female shopper whips off her THONG and wears it as a Covid face mask after supermarket staff refused to serve her.

Good for her!

https://www.the-sun.com/news/2411562/shopper-thong-wears-as-covid-facemask-supermarket/

The viral clip shows the female customer remove her undies to put on her face after being warned she would not be served without a Covid mask on.
The bizarre incident was caught on camera at a Pick n Pay supermarket in South Africa, and has since caused quite a stir online.

The shopper was asked to put on a face covering by a security guard, but claimed she did not have one.

After threatening to remove her from the store, footage shows the woman then reach under her dress and whip off her thong to use as a makeshift mask.

Another female shopper, reportedly the same woman who went viral earlier in the week for telling supermarket staff to remove their face masks, appeared to congratulate her, saying "well done".

The clip has sparked outrage online with many blasting the woman for entering the shop without a face mask on.

One Facebook user said: "Stay at home and do online shopping if you don’t like the idea of wearing a mask."

Another commented: "This makes me sick. She is aware of the law worldwide.

"We have a serious virus and (she thinks) a G-string will save her. Come on grow up. What must your family think?"

monty
26th February 2021, 04:06 PM
I saw that video maybe it was on bitchute, a couple of weeks ago.

PatColo
26th February 2021, 04:31 PM
looks like Dachsie last posted here Feb 7th (or 8th UTC time)
http://gold-silver.us/forum/member.php?22568-Dachsie

I don't expect anyone knows her IRL but JIC, anyone know if she's ok?

hope she didn't get the joo gene therapy jab, & .....:'(

ETA: she's said more than once she's in Travis County TX near Austin... #TexasFreeze


separately, this site's da bomb, browse article titles: https://humansarefree.com - I've been gabbing the shite out of them

woodman
26th February 2021, 06:26 PM
looks like Dachsie last posted here Feb 7th (or 8th UTC time)
http://gold-silver.us/forum/member.php?22568-Dachsie

I don't expect anyone knows her IRL but JIC, anyone know if she's ok?

hope she didn't get the joo gene therapy jab, & .....:'(

ETA: she's said more than once she's in Travis County TX near Austin... #TexasFreeze


separately, this site's da bomb, browse article titles: https://humansarefree.com - I've been gabbing the shite out of them
Amanda seems to be gone also. These two ladies are very important posters here. What has happened to them?

monty
26th February 2021, 07:13 PM
Amanda seems to be gone also. These two ladies are very important posters here. What has happened to them?
Seems to me Amanda bailed out just before Pedo Joe was inaugurated. I think the stolen election was real hard on her emotionally.

Amanda
27th February 2021, 05:47 PM
Seems to me Amanda bailed out just before Pedo Joe was inaugurated. I think the stolen election was real hard on her emotionally.

Hi all. Fwiw- I actually had a major problem with my lower back on Jan 18- worst pain of my life. Took me about a month to get better (I couldn't even sit at the computer b/c it caused lower back pain). I'm a lot better now and it looks like I might actually have a severe reaction to nightshades. I have Dr. Sherry Roger's book "Pain free in 6 weeks" and she says severe pain could be due to nightshades (she has this same problem and said it can be so bad that it looks like you need back surgery, which is how I felt). So, I'm off nightshades (tomatoes, peppers, eggplant, and potatoes) and am almost all better. She also said to avoid soy because it is GMO'd with a gene from a petunia, which is also an apparent nightshade). I think she's probably right because when I accidentally had a piece of bread that had soy in it, my pain came back.

I also needed a break from the never-ending covid hoax insanity.

woodman
27th February 2021, 06:07 PM
Hi all. Fwiw- I actually had a major problem with my lower back on Jan 18- worst pain of my life. Took me about a month to get better (I couldn't even sit at the computer b/c it caused lower back pain). I'm a lot better now and it looks like I might actually have a severe reaction to nightshades. I have Dr. Sherry Roger's book "Pain free in 6 weeks" and she says severe pain could be due to nightshades (she has this same problem and said it can be so bad that it looks like you need back surgery, which is how I felt). So, I'm off nightshades (tomatoes, peppers, eggplant, and potatoes) and am almost all better. She also said to avoid soy because it is GMO'd with a gene from a petunia, which is also an apparent nightshade). I think she's probably right because when I accidentally had a piece of bread that had soy in it, my pain came back.

I also needed a break from the never-ending covid hoax insanity.
Good to see you post Amanda. Hope you recover quickly and completely.

monty
27th February 2021, 09:04 PM
Hi all. Fwiw- I actually had a major problem with my lower back on Jan 18- worst pain of my life. Took me about a month to get better (I couldn't even sit at the computer b/c it caused lower back pain). I'm a lot better now and it looks like I might actually have a severe reaction to nightshades. I have Dr. Sherry Roger's book "Pain free in 6 weeks" and she says severe pain could be due to nightshades (she has this same problem and said it can be so bad that it looks like you need back surgery, which is how I felt). So, I'm off nightshades (tomatoes, peppers, eggplant, and potatoes) and am almost all better. She also said to avoid soy because it is GMO'd with a gene from a petunia, which is also an apparent nightshade). I think she's probably right because when I accidentally had a piece of bread that had soy in it, my pain came back.

I also needed a break from the never-ending covid hoax insanity.

Welcome back. I know what you mean about the back pain. About 18 months ago I had severe lower back pains which is caused from arthritis in my pelvis pushing against my tail bone. Reading about sciatica and arthritis one of the things I read was eliminate night shades. I stopped eating them and have pretty much eliminated the pains but some types of activity seems to aggravate it now and then.

Bigjon
28th February 2021, 10:28 AM
Welcome back. I know what you mean about the back pain. About 18 months ago I had severe lower back pains which is caused from arthritis in my pelvis pushing against my tail bone. Reading about sciatica and arthritis one of the things I read was eliminate night shades. I stopped eating them and have pretty much eliminated the pains but some types of activity seems to aggravate it now and then.

Borax is supposedly a cure for arthritis.

https://www.earthclinic.com/borax-remedy-for-arthritis.html
Just a site found by search engine.

monty
28th February 2021, 12:28 PM
Borax is supposedly a cure for arthritis.

https://www.earthclinic.com/borax-remedy-for-arthritis.html
Just a site found by search engine.thanks. I’ll give it a try

woodman
28th February 2021, 02:39 PM
Borax is supposedly a cure for arthritis.

https://www.earthclinic.com/borax-remedy-for-arthritis.html
Just a site found by search engine.
Very interesting reading. The link would not work for me so I copied it partially and hit the articles.

Here's another article: Health-Science-Spirit - The Borax Conspiracy (health-science-spirit.com) (http://www.health-science-spirit.com/Healing_the_Body/The-Borax-Conspiracy.html)

PatColo
28th February 2021, 03:48 PM
some recent interviews Fetzer's been mirroring @ his BC ch: https://www.bitchute.com/channel/Rbtrop3rRlZl/ - Dr Carrie Madej, Dr. Andy Kaufman w Sarah Westall, & this must-watch, my first exposure to Dr. Lee Merritt, what a firecracker! 68m:


Feb 28, 2021
The Rise of Medical Technocracy and the Truth of Viral Treatments - Interview with Dr. Lee Merritt (https://www.bitchute.com/video/htXc7XgBiGAC/)

FABULOUS overview by Dr. Lee Merritt at her best: Everything makes sense when you understand that this is a "Purposeful take-down of our society." Covid is an act of stealth warfare against Christian-based Western Civilization. The corruption of the medical profession and why the coronavirus vaccines are dangerous bioweapons being deployed against the people.

Dr. Merritt has taken two oaths: the Hippocratic Oath and the Oath to the Constitution as a Naval Officer. She is in this fight to support those two oaths.
The treatment of viral diseases: Has the truth been suppressed for decades?

The Dr Kaufman interview is also a nice break from the usual hard bioscience talk, w more focus on the (((engineered mass-psychosis))) in play - find it @ Fetzer's BC ch above.

PatColo
28th February 2021, 03:55 PM
Must watch 2m clip (kill it @ 1:55 to skip AJ's tangy tangerine penis pills pitch):

TV Doctor Shames Black Woman To Take Experimental Vaccine
(https://www.infowars.com/posts/tv-doctor-shames-black-woman-to-take-experimental-vaccine/)
Infowars.com
February 27th 2021

Talk show host Wendy (:D )( :D) Williams reveals her skepticism about the coronavirus vaccine’s efficacy to Dr. Oz, who then tried to shame her into receiving it.

monty
28th February 2021, 05:24 PM
Borax is supposedly a cure for arthritis.

https://www.earthclinic.com/borax-remedy-for-arthritis.html
Just a site found by search engine.

A video from the Earth Clinic



http://youtu.be/p6x-9A6pEJc

https://youtu.be/p6x-9A6pEJc

PatColo
2nd March 2021, 12:49 PM
fascinating new guest on Rense hr 2 last night, w insight from research + his speculation re the history & current situation of the mysterious deagel.com & its world nation by nation 'depopulation forecast for 2025'

Download (https://ln2.sync.com/dl/c75400810/ung8a6p2-j8m25qi9-p5nnrsyc-tp93ja7a) Hour 1 - Donald Jeffries (https://donaldjeffries.wordpress.com/) - The State Of This Fractured Nation

Download (https://ln2.sync.com/dl/63d5347e0/7u26xthq-rmd33hmr-pidtv7ez-zzqpwn99) Hour 2 - James Karolak - Shocking News About The Deagel.com Forecast (https://www.deagel.com/forecast)

Download (https://ln2.sync.com/dl/28ad20630/7ziehxe4-tqr2fpzb-3wmd59hf-hu4spt2h) Hour 3 - Mitchell Henderson - Move Towards War, COVID Truth and the US Political Situation

woodman
2nd March 2021, 03:24 PM
fascinating new guest on Rense hr 2 last night, w insight from research + his speculation re the history & current situation of the mysterious deagel.com & its world nation by nation 'depopulation forecast for 2025'

Download (https://ln2.sync.com/dl/c75400810/ung8a6p2-j8m25qi9-p5nnrsyc-tp93ja7a) Hour 1 - Donald Jeffries (https://donaldjeffries.wordpress.com/) - The State Of This Fractured Nation

Download (https://ln2.sync.com/dl/63d5347e0/7u26xthq-rmd33hmr-pidtv7ez-zzqpwn99) Hour 2 - James Karolak - Shocking News About The Deagel.com Forecast (https://www.deagel.com/forecast)

Download (https://ln2.sync.com/dl/28ad20630/7ziehxe4-tqr2fpzb-3wmd59hf-hu4spt2h) Hour 3 - Mitchell Henderson - Move Towards War, COVID Truth and the US Political Situation
I find myself getting irritated with Rense. I wish he would shut up and let his guests speak.

PatColo
2nd March 2021, 03:43 PM
^ at least JR finally stopped having "Dr. Henry Niman" on 5 nights/week, spoiling hr 3 which could be filled with more enjoyable guests. Niman would just regurgitate a bunch official MuhRona hoax "facts & figures" :rolleyes: -- I figured JR was just doing this to help move all his sponsors' health/wellness merch; but I think even JR finally tired of Niman, who was little more than an MSM-style fear mongerer.

nowdaze instead, when JR wants to spoil his hr 3 (IE he's hard up to fill the hour), he goes with David "Reverse Speech" Oates, who's apparently always willing/able... blah! :'(

PatColo
3rd March 2021, 12:46 PM
rense last night

Download (https://ln2.sync.com/dl/1b6f4e540/en4pwshs-fd4wpnm4-sfrzn7j2-chh9c7x9) Hour 1 - Dr David Duke (http://davidduke.com/) - The State of the Nation

Download (https://ln2.sync.com/dl/d276be320/cj4cumr8-2vqcg2ni-qf6ebzhy-67sibhu5) Hour 2 - Dr. Erica Khan - Update On The 'Vaccine' And Test Swabs

Download (https://ln2.sync.com/dl/ed10612a0/puczbic5-hrq72uj3-w4n4c9ai-kpj4cmxk) Hour 3 - Catherine Austin Fitts (http://deliberatedumbingdown.com/) - Incredible, New Solari Family Financial Disclosure Form For Covid-19 Injections


this meme cracks me up - someone posted in connection w the story TX gov'r Abbott "opened TX 100%"
https://gab.com/RichardL/posts/105823734257779386

https://media.gab.com/system/media_attachments/files/067/504/606/original/cda130d006cedd3f.jpg

PatColo
3rd March 2021, 01:04 PM
Sherri Tenpenny's been re-promoting her Aug 2020 article below, saying trans-humanism awareness is on the rise as ppl learn about the mRNA bioweapon,


DNA, Vaccines, and Transhumanism (https://vaxxter.com/dna_vaccines_transhumanism/)

TOPICS:Autoimmunity (https://vaxxter.com/tag/autoimmunity/) Cancer (https://vaxxter.com/tag/cancer/) DNA Vaccines (https://vaxxter.com/tag/dna-vaccines/) Nanotechnology (https://vaxxter.com/tag/nanotechnology/) Transhumanism (https://vaxxter.com/tag/transhumanism/)

https://i0.wp.com/vaxxter.com/wp-content/uploads/2019/08/Transhuman_Brain_dreamstime_xs_150055541.jpg?resiz e=480%2C320&ssl=1

POSTED BY: VAXXTERADMIN2 (https://vaxxter.com/author/drsherrit/) 08/31/2020
Dr. Sherri Tenpenny, DO, AOBNMM, ABIHM

Transhumanism is a futuristic concept where man and technology blend (http://whatistranshumanism.org/#what-is-transhumanism), resulting in soulless intelligent machines. It is a movement that favors the evolution of a new species of human through the use of integrative circuitry. Referred to as “human betterment for the post-human era,” transhumanists assume that humanity will only be enhanced by machines. No damage. No degradation. And no possibility for coercion or domination. In a post-human world, humanity as we know it will be obsolete.

moar: https://vaxxter.com/dna_vaccines_transhumanism/

PatColo
3rd March 2021, 01:35 PM
great little 9s zuckerberg vid, u gabbers can repost,
https://gab.com/Necromonger1/posts/105814540069950807

or save a copy here to re-up to other platforms, it's 1.36 MB
https://media.gab.com/system/media_attachments/files/067/299/939/original/6e2010b8af33fdf3.mp4

https://media.gab.com/system/media_attachments/files/067/299/939/original/6e2010b8af33fdf3.mp4

PatColo
3rd March 2021, 03:09 PM
new dr. carrie, 62m:

Under the Wire - A conversation with Dr Carrie Madej
(https://rumble.com/ve9tu3-under-the-wire-a-conversation-with-dr-carrie-madej.html)
Under The Wire (https://rumble.com/c/c-507655)Published March 1, 2021


Israel Implements ‘Freedom Bracelet’ Tracking Device For Travelers (For A Virus With A 99.95% Survival Rate For People Under 70) (https://humansarefree.com/2021/03/israel-implements-freedom-bracelet-tracking-device-for-travelers-for-a-virus-with-a-99-95-survival-rate-for-people-under-70.html)

HAF (https://humansarefree.com/author/ascanu) March 3, 2021

This is definitely NOT freedom.
by Steve Watson (https://summit.news/2021/03/02/freedom-bracelet-tracking-device-launched-in-israel-as-alternative-to-quarantine/)

https://humansarefree.com/wp-content/uploads/2021/03/Israel-Implements-%E2%80%98Freedom-Bracelet-Tracking-Device-for-Travelers.jpg
Photo by Ilia Yefimovich/picture alliance via Getty Images

Israel has rolled out what it is calling a ‘Freedom bracelet’, a tracking device that will serve as an alternative to a two-week quarantine for anyone entering the country from abroad.

moar https://humansarefree.com/2021/03/israel-implements-freedom-bracelet-tracking-device-for-travelers-for-a-virus-with-a-99-95-survival-rate-for-people-under-70.html



https://humansarefree.com/wp-content/uploads/2021/03/Satanic-Temple-in-Texas-Files-Lawsuit-Demanding-Religious-Right-to-Sacrifice-Babies-Through-Abortion-780x450.jpg
(https://humansarefree.com/2021/03/satanic-temple-in-texas-files-lawsuit-demanding-religious-right-to-sacrifice-babies-through-abortion.html)
NEWS (https://humansarefree.com/category/news)PLANNED PARENTHOOD (https://humansarefree.com/category/planned-parenthood)SATANISM (https://humansarefree.com/category/satanism)
Satanic Temple In Texas Files Lawsuit Demanding ‘Religious Right’ To Sacrifice Babies Through Abortion (https://humansarefree.com/2021/03/satanic-temple-in-texas-files-lawsuit-demanding-religious-right-to-sacrifice-babies-through-abortion.html)

https://humansarefree.com/wp-content/uploads/2020/09/HAF-Logo-64x64.pngMarch 3, 2021






[/COLOR]
https://humansarefree.com/wp-content/uploads/2021/03/Jodie-Jones-manager-of-Fairways-Newydd-Nursing-and-Dementia-Care-Centre.jpg
(https://humansarefree.com/2021/03/12-residents-die-after-first-covid-vaccine-in-wales-nursing-and-dementia-care-centre.html)
CORONAVIRUS (https://humansarefree.com/category/coronavirus)NEWS (https://humansarefree.com/category/news)VACCINES (https://humansarefree.com/category/vaccines)
12 Residents Die After First COVID Vaccine In Wales Nursing And Dementia Care Centre (https://humansarefree.com/2021/03/12-residents-die-after-first-covid-vaccine-in-wales-nursing-and-dementia-care-centre.html)

https://humansarefree.com/wp-content/uploads/2020/09/HAF-Logo-64x64.pngMarch 3, 2021

woodman
3rd March 2021, 04:56 PM
rense last night

Download (https://ln2.sync.com/dl/1b6f4e540/en4pwshs-fd4wpnm4-sfrzn7j2-chh9c7x9) Hour 1 - Dr David Duke (http://davidduke.com/) - The State of the Nation

Download (https://ln2.sync.com/dl/d276be320/cj4cumr8-2vqcg2ni-qf6ebzhy-67sibhu5) Hour 2 - Dr. Erica Khan - Update On The 'Vaccine' And Test Swabs

Download (https://ln2.sync.com/dl/ed10612a0/puczbic5-hrq72uj3-w4n4c9ai-kpj4cmxk) Hour 3 - Catherine Austin Fitts (http://deliberatedumbingdown.com/) - Incredible, New Solari Family Financial Disclosure Form For Covid-19 Injections


this meme cracks me up - someone posted in connection w the story TX gov'r Abbott "opened TX 100%"
https://gab.com/RichardL/posts/105823734257779386

https://media.gab.com/system/media_attachments/files/067/504/606/original/cda130d006cedd3f.jpg
Great stuff Pat. I feel bad for dissin' Rense for breaking into his guests dialogue. Rense really has done a lot of good.

PatColo
4th March 2021, 12:08 AM
WOW I wasn't aware of @RealMikeLindell (https://gab.com/RealMikeLindell)'s interview w RSBN @ #CPAC (https://gab.com/tags/CPAC) last weekend. He began talking about the MuhRONA!™ & vaccines as #MarkOfTheBeast (https://gab.com/tags/MarkOfTheBeast), and ISRAEL; RSBN had to cut him off for fear of his CoVaxx talk giving ThemTube 'cause' to shoah RSBN's whole channel there.

Last Mon's @TRUNEWS (https://gab.com/TRUNEWS) Godcast covered the story, incl the Mike/RSBN clip, beginning just a few minutes in:

FORBIDDEN: MIKE LINDELL’S VACCINE TALK CENSORED BY RIGHT SIDE BROADCASTING
https://www.trunews.com/stream/forbidden-mike-lindell-s-vaccine-talk-censored-by-right-side-broadcasting
(https://www.trunews.com/stream/forbidden-mike-lindell-s-vaccine-talk-censored-by-right-side-broadcasting)
MAR 1 - Today on TruNews, we discuss RSBN’s censorship of My Pillow’s CEO at CPAC, as he attempted to share his beliefs that the mandatory COVID vaccines in Israel are leading the world toward the Mark of the Beast warned about in the Revelation of Jesus Christ. [...]

PatColo
4th March 2021, 09:40 AM
RE ^ noticed this pub'd Tues Mar 2, RSBN & @RealMikeLindell (https://gab.com/RealMikeLindell) did a little patch-up piece together. IMHO, it's a stretch to imagine Mike "told RSBN to mute his mic", but that's the tact they took here. Both parties are on the same page re RSBN "staying in the game" as they work on getting a more secure platform.

Interview with My Pillow CEO Mike Lindell on RSBN "Mic Muting" Incident at CPAC
47,321 views • Streamed live on Mar 2, 2021
Right Side Broadcasting Network
6 mins: youtube.com/watch?v=rEzawWxL1Tk (https://www.youtube.com/watch?v=rEzawWxL1Tk)


https://www.youtube.com/watch?v=rEzawWxL1Tk