Cynthia McKinney RT'd this; 1m 48s clip inside, re what's 'scheduled' for next week -- "You know what's going on by now..."
https://twitter.com/SovMichael/statu...01679634522115
For your information:
A nurse in Broward County, Florida.
Printable View
Cynthia McKinney RT'd this; 1m 48s clip inside, re what's 'scheduled' for next week -- "You know what's going on by now..."
https://twitter.com/SovMichael/statu...01679634522115
For your information:
A nurse in Broward County, Florida.
I'll just post the occasional above-average 'rona vid/podcast here -- it's a 'superior' thread coz Dachsie didn't post it under "General Discussion" which, AFAIK, is the only subforum which prohibits posting images! :rolleyes:
Tim & Joe's Sat show (recorded Fri's) is already posted; find them all at
https://tkelly6785757.podomatic.com/
^ listening to this now; @ ~50m Joe tells the story of Schumer getting heckled by a really articulate woman on the street in NYC - here's a 2m 20s clip of that:Quote:
Originally Posted by PatColo
https://twitter.com/jacobkornbluh/st...73414456291333
it could actually really use subtitles -- often hard to understand her with her face diaper muffling her like that
"You know what's going on by now."Quote:
Originally Posted by PatColo
This whole corrupt system needs to be taken down right now. What's going on is eugenics, population control, Dr. Josef Mengala style. One world death and slavery system for all.
There is going to be a "covid crisis" next week that will necessitate this hospital in Broward County Florida giving up post surgery recovery room space to this satanic "covid" deception scheduled for next week.
God bless this brave woman who shared this important information. Pray for her. Lin Wood talks a big talk, but this humble health care provider DELIVERED.
This covid operation has been quite successful in causing thinking people to be totally distrustful of their doctor and their hospitals and medical care in general. Divide and conquer and get us all at odds with each other. Communist playbook 101
"Jacob KornbluhQuote:
Originally Posted by PatColo
@jacobkornbluh
Heckler calls Schumer “an antisemite.”
"
refers to this wise woman as a "heckler".
Schumer is FILTH who worships THE FATHER OF LIES.
Just to be extra clear.
Pelosi and McConnell had total control and authority over the Capitol police on January 6, 2021 false orchestrated event of these evildoers. They should be arrested, given military trial. and meted out the harshest punishment for Treason and Sedition. Every tiny element of that staged Jan 6 event wreaks with falsity.
We the people hunger and thirst for justice because we love the One who is Truth.
^ me fears this Broward nurse will be losing her job soon -- that's what happened to at least one nurse in UK who vented about the BS. The nail sticking up gets the hammer -- but what if more & more vent publicly like this?!Quote:
Originally Posted by Dachsie
It's a great show, like with the majority of hospital/med workers who are rejecting the jab -- what can the (((hoaxers))) do about that dilemma?! :D
Quote:
Originally Posted by PatColo
a note re Tim's Tue 1/12 show with guest Eric Karlstrom, found at link above -- I only made it through ~half of this. I've listened to plenty of Eric K over the past several years, mostly on Rense, ACHitchcock, Tim K, & I think even Spingola from ~7+ years ago when I could last tolerate her, pre-Sandy Hoax sellout.
Eric's "talent" for LOOOONG monologs where the show host can just mute, & go make themselves a snack, toilet run, refill coffee, whatever... kind of wear me down. I much prefer a 2 way dialog! Erik does seem to get it, the whole big picture, but being immersed in this stuff myself over the years, I find I don't learn much if anything new from him anymore. The odd times he speaks of something, some tech maybe, that I'm not already versed on -- it usually "rings true." But otherwise, Eric hits my ears as just another voice regurgitating the same message any more -- poor "signal to repetition ratio", you could say.
That's surely not true for newer listeners though, transitioning from normie-dom to red pilled, so I don't fault Eric making the rounds. I'll just tend to search out new voices instead, when I see he's back as guest du jour in my regular podcast circuit.
edit - AU's "Peekay Truth", a voice we don't hear from much anymore coz (((Muh Big Tech Censorship))), was on with Fetzer a couple days ago:
THE FETZ PRESENTS (14 JAN 21): PEEKAY FROM DOWNUNDER - THE CORONAVIRUS HOAX AND OTHER MASS ILLUSIONS
^ heh; "THE FETZ" is awfully close to stepping on the toes of Dennis "The Fetch" Fetcho
Agree one hundred percent about Karlstrom. I wrote him one time and aksed a question. He replied by trying to sell me some of his music products.
^ lolz; that's gratifying to hear -- wasn't sure if I was being a stick in the mud re Karlstrom. He seems to be sort of an aggregator of other people's original work, making him like "Jack of all [conspiracies], Master of none." Well if I had to characterize my own 'hobby-ism" re conspiracies, that would describe me too! So, pot > kettle > black I suppose. I mostly just convey info back & forth re good info/shows, usu adding my own "intuition" thoughts.
Eric's long claimed to be a TI (Targeted Individual), but then oddly, I don't recall him ever detailing his own personal experiences with that, IE what EM weapons they've hit him with, what "street theater" experiences, what remedial steps he's taken etc. This is one area where he could really shine, bringing his unique story to the table, but he doesn't!
Instead he's on show after show, giving these motor-mouth/monolog regurgitations of other people's original research. Didn't he say his (former?) profession was being a history prof at a local community college?
"I believe in capital punishment so long as is ain't too severe."Quote:
Originally Posted by Dachsie
Edith Bunker
https://static-3.bitchute.com/live/c...97_640x360.jpg
51:58 video runtime
https://www.bitchute.com/video/ybnzP2q2AA97/
The Science of mRNA Vaccines - Dr. Tom Cowan
First published at 18:26 UTC on January 16th, 2021.
channel image
Jim Fetzer
Jim Fetzer
3125 subscribers
EXTREMELY GOOD explanation of RNA, DNA and mRNA and how the functions of those elements of cellular biology will be impacted by the synthetic mRNA vaccines being rolled out. Dr. Tom Cowan, a “visionary” medical thinker, takes on the subject of the new mRNA “vaccines.” He spells it ‘vacations’ in order to avoid YouTube censorship. He also refers to a vaccine as a ‘vacation’ in the video for the same reason.
I'll just drop this here...
Episode 393 – The 4th Annual Fake News Awards!
Corbett • 01/16/2021 • 17 Comments
http://enformtk.u-aizu.ac.jp/howard/fuellmich/
— title: Fuellmich's newsletter of Jan 6, 2021 layout: reports —
Newsletter 355, 06.01.2021: Money Talks VI and the worldwide lawsuits
(this is an ad-hoc translation by Paul Charles Gregory BDÜ of the original German text by Dr. Reiner Fuellmich)
Table of Contents:
- Status of the PCR lawsuit at the Regional Court of Berlin
- Lawsuit on PCR test submitted in New York
- Portugal and Ecuador show Germany who the real banana republic is
- Canada submits first class action suit for compensation which will be an international class action
- Further points: Lawsuit against the EU Commission for its approval of the vaccine to be declared null & void; constitutional complaint lodged against the measures by a German judge
Ladies and Gentlemen,
Despite everything, or indeed in view of everything, let us first wish you all a cheerful New Year for 2021. Before we inform you about the state of play of the Corona lawsuits, and in particular the class actions, here is a reminder of the background against which all this is happening:
The hearings conducted by the Berlin Corona Committee since July 10, 2020, and attended by some one hundred internationally prominent scientists, medics, economists, lawyers and people badly affected, have determined – as of today – that at no point was the Corona scandal about health. This is because:
- As explained in the last newsletter, the danger presented by this allegedly new virus can be compared to that of influenza – this is the conclusion not only of studies by Prof. John Ioannidis of Stanford University but also the assessment of the World Health Organisation.
- The Drosten-PCR-Tests, which were devised in January 2020, are not remotely suitable for determining whether someone is infected or not, despite being recommended as the global Gold Standard for determining infection by the WHO; it should be noted that the leadership of this organisation is under the financial control of China and the Bill & Melinda Gates Foundation (the WHO certainly has good employees – as too does the Robert-Koch Institute, despite its incompetent management).
In a retraction paper, a score of highly regarded international scientists have called on the editors of the journal which published the PCR tests as a measurement method for infections to withdraw the mischief forthwith. This test is not only scientific nonsense, but was obviously designed to create as many false positives as possible and so spread panic in the world. This English language retraction paper has been viewed about 18 million times:
www.cormandrostenreview.com
Furthermore, a second assertion made in January 2020 by Drosten that there are asymptomatic infections is false. These do not exist, as documented most recently by a major survey of ten million people from Wuhan of all places:
https://doi.org/10.1038/s41467-020-19802-w
A person who has no symptoms is healthy. This means that no-one need be fearful of people without symptoms or force them to wear masks, and no-one must be frightened that a positive test means that the person who has tested positive is infected. Horror pictures of hospitals with beds in the corridors are again doing the rounds – such scenes occur every year during a completely normal influenza outbreak (we will be glad to make available a kaleidoscope with such pictures of recent years taken from the mainstream media): such pictures are used solely in order to spread panic. There is still no excess mortality in Germany – it is perfectly normal for more people to die in winter.
So what is really at issue, if there is no health problem different to the normal surge of influenza? Here, too, we have been able to form an impression from the hearings we have conducted and from more ancillary information.
As of today, it must be assumed that, in September 2019, the Davos clique, as we call them, was about to go up in smoke. This group of self-appointed corporate elites and top politicians has met annually for at least 20 years under the auspices of the World Economic Forum (WEF), which is a private organisation. What happened was that, in September 2019, there was a further financial crash, even bigger than that of the Lehman crisis 12 years ago. This was reported on only briefly (by, among others and very competently, the German weekly broadsheet Die Zeit), after which the reporting went silent again. The financial system was again on the brink of collapse because there was a menace of it becoming visible that, for at least 20 years, its sole purpose had been to plunder the taxpayers to the benefit of the Mafia-like operations. In other words: to shift the assets of the broad mass of citizens to business concer ns. The best example of this are the ‘Cum-ex deals’, which are still unpunished, with the help of which banks, concerns and the super-rich were reimbursed twice or three times for taxes that they had paid just once. It is understandable that it might be possible to have reimbursed a tax payment of € 10 million. But not that instead, 20 or 30 million can be demanded back – this is something that everyone will find obvious, with or without a degree in law. This way the above-mentioned insiders obtained over many years a total of € 38 billion by defrauding the taxpayers. This was only possible because they were given cover by politicians – who over at least the last 20 years in particular have been made compliant by the relevant elites through the private WEF meetings. The fact that the courts in Germany failed to act shows that those mentioned are able, via the political scene, to influence what happens in the courts.
We had long seen that something was amiss during our lawsuits about bank liability in connection with finance for dilapidated buildings. For there, too, it emerged that Deutsche Bank in particular had a direct line to the courts and had made the judges into errand boys without a mind of their own. (Incidentally, the former head of Deutsche Bank, Josef Ackermann, not only met Merkel & Co regularly in Davos but celebrated his sixtieth birthday directly in the chancellory with Merkel.) This explains why German judges – blindly – adopted in their pronouncements the assertion of Deutsche Bank that it was normal for a bank to issue loans without a loan agreement in the hope that, sometime later, it would be possible to conclude a suitable loan contract; the thinking being that the issue of a loan at the request of a potential borrower leads to a loan contract being concluded, yet since, at this time, Deutsche Bank did not have the documents necessary for a valid contract, it was not possible for a court to determine that a contract had come about merely by the funds being made available – because if it had, the Deutsche Bank would have sunk like a stone – except that none of us had imagined that the Deutsche Bank was only one part of the Davos clique, albeit a most important member for purposes of money laundering, and that today we have to reckon with a thoroughly corrupt elite which will stop at nothing.
In his report “Pandemic Games”, Paul Schreyer has described very lucidly this entanglement of corporate “elites” and political “elites,” which has become ever deeper over the last 20 years. There he also illustrates how these elites have been attempting, in a targeted and practised manner, not only to retain illegitimate power but even to extend such power indefinitely with the aid of the most massive and cynical control mechanisms before the objects of these control mechanisms – which is us – can notice and rebel against it.
https://www.youtube.com/watch?v=SSnJhHOU_28
In his lecture “Why do the lambs not speak up,” Professor Rainer Mausfeld explained in turn (incidentally, already at the beginning of 2019 and so entirely independently of the Corona story) how over many years politics has repeatedly manufactured fear and panic, without the general public realising what was happening, in order to get people to support political decisions which they would otherwise reject.
https://www.youtube.com/watch?v=-kLzmatet8w
The former US deputy minister of housing construction and investment banker Catherine Austin Fitts explains in her documentary film “Catherine Austin Fitts Full Interview Planet Lockdown” how these “elites” are currently implementing the takeover of the assets of the middle classes or are trying to (because if only 10% of the population notice this, the house of cards will collapse, some thinkers assume an even lower percentage). With the focus here on the USA, but certainly applicable to elsewhere, one of the ways in which this is happening is that, first of all, areas with small and medium-sized businesses, for example restaurants and retailers, are closed via Lockdown so that their owners can no longer make a living, and in particular that they can no longer pay back any loans they have taken out. Although aid packages are announced, these are disbursed only sparingly if at all. Thereafter – and this may apply specifically only to the USA – riots are organised in these areas, which lead to the additional destruction of these businesses so that they can no longer be sold even in a fire sale. Thereafter, investors with tax breaks and from the aforementioned Davos clique can acquire these businesses for next to nothing.
Link to interview with Catherine Austin Fitts
On the lawsuits
As you will know, a number of institutions and law firms have coordinated worldwide in order to have the courts ascertain the background illustrated above and in order afterwards to demand compensation from the ringleaders and concerns for the many who have been harmed by the Drosten-Test lockdown.
The lawsuits being pursued globally are not uncoordinated – they are largely the result of detailed joint planning by the scientists and lawyers involved. The two facts (i) that the Drosten-Test recommended globally by the WHO cannot detect infection, and (ii) that there are no asymptomatic infections (and therefore no real pandemic, at most a PCR casedemic) are of central importance for the outcome of the lawsuits. These facts will cause the house of cards of the pandemic fraudsters to collapse everywhere.
It also follows that whatever is established in the USA, Canada, Australia, Italy, France etc. in this context, (using the help of witnesses and experts, as well as expert opinions) can also be used as evidence in all other courts of the world.
I. Our PCR test complaint on behalf of Dr. Wodarg and the complaint against Drosten and subsequent complaints
The complaint is pending at the Regional Court of Berlin under the file number 27 O 436/20. On account of an “oversight” – which we consider very strange – the complaint was only delivered to the opposing party weeks after its submission. It was alleged that the court fees which we had remitted had erroneously been booked as payment for a final settlement of accounts and only when – after our phone call – this "oversight" was put right was the complaint formally delivered. We are now waiting for the opposing party to reply.
The complaint against Drosten is based on the Cease-and-Desist letter to Drosten:
http://bit.ly/3rcnWlB
(Original German version: http://bit.ly/3nrn62b )
The complaint will be completed in the coming days and then, it too, will be submitted to the Regional Court of Berlin. Together with a group of lawyers we are working on a number of further precedence case complaints, but above all (because this is faster and less expensive) also on many cease and desist letters against those in positions of responsibility. This way we obtain in effect something like a German class action. The cease and desist letters ensure that the visible puppets Drosten, Wieler, but also the members of The Leopoldina National Academy of Sciences and others including the individuals who, in their official capacities, bear personal responsibility for imposition of quarantine and similar measures – the cease and desist letters ensure that these people are put under pressure even if, thereafter, the necessary justification of the claims arising from the letters will need many months. In this time, a few of the precedence case lawsuits (which all concern the PCR tests and asymptomatic infections) will proceed by taking evidence (i.e. questioning of ordinary and expert witnesses and the drafting of expertises). Their results can then be used for rulings on the parallel “dormant” proceedings: the lawsuits dormant until this point of time will not be able to come to any other conclusion since the facts will have been established in the parallel precedence cases.
II. PCR test lawsuit in New York
On December 16, 2020, the US colleagues working with Robert F Kennedy, Jr´s Children’s Health Defense and advised by the same experts as ourselves, submitted a PCR test complaint in New York on behalf of a number of plaintiffs.
Translator’s note: Supplementary information describing the PCR test complaint will be issued shortly as an update to this translation.III. The Canadian class action, which will develop to be an international class action for all those harmed by the Drosten-PCR-Test-Lockdowns
In the last week Canadian colleagues working with Michael Swinwood have submitted a class action. It is being added to, on the instructions of the court. The complainants initially represented are Indians, a group of small business people and a representative of disabled people. In contrast to all complaints submitted to date, this complaint narrates briefly the historical background of the power structures behind the Davos clique which have been constructed over the course of centuries.
Translator’s note: Supplementary information describing the class action will be issued shortly as an update to this translation.The Indians (Algonquin) as a complainant group are of special significance since they – together with the Indians of the USA and Latin America – have for centuries been the object of attempted genocide by the conquerors. In the words of Michael Swinwood, “We are all Indians now.”
IV. Court rulings from Portugal and Ecuador
- Some weeks ago, an appeal court in Portugal ruled that the PCR tests are not able to ascertain infection let alone illness, which is exactly what the inventor of the PCR tests, the Nobel Prizewinner Kary Mullis repeatedly emphasised - At is sue was the case of four German tourists, one of whom had tested positive, and all of whom the authorities had placed under what the court determined to be a kind of house arrest – similar to the action of German administrative courts who follow blindly German fake science; thereby the appeal court confirmed an earlier finding that the quarantine was unconstitutional.
This judgement is a slap in the face for the German administrative courts, which were forced to concede that PCR tests cannot ascertain the presence of infection but nonetheless – in a case of crass perversion of justice – imagined that they had to follow the instructions of the Robert Koch Institute in its reliance on PCR tests and assumed that the healthcare system was on the brink of being overwhelmed (e.g. Higher Administrative Court Münster) – in this respect the Portuguese judgement demoted the German administrative courts to the status of banana republic. This is the shape of lessons in the rule of law by a Portuguese for a German court (the judgement linked to is in Portuguese so may need professional or machine translation).
- A judgement pronounced on January 2, 2021, by the Constitutional Court of Ecuador ruled that all anti-Corona measures to date are based on mere conjectures without any basis in fact. After nine months it should finally be possible for the acting politicians to communicate clear, evidence-based assertions and base their measures on these. But since this has not happened, all the measures are unconstitutional. Below is the link to the judgement (we shall publish the judgement itself in the original on the website of the Corona Committee).
https://ricapod.buzzsprout.com/1409218/7133344-verfassungsgericht-kippt-ausnahmezustand-wir-machen-auf?fbclid=IwAR2xBQvUz63NMA3VGglPOxC2UCy3Fxfh_tveV RsBUSwFmLkdnsrdCYCwTao
Not one of the German administrative courts ruling on urgent injunctions nor indeed the Federal Constitutional Court have made any such pronouncement for Germany although of course the finding applies equally for Germany. This is a lesson from an Ecuadoran Court in the rule of law for the German courts.
V. Lawsuit to declare void vaccine approval; constitutional complaint by a German judge against the measures of a Federal Government which has practically been kidnapped by the Davos Clique – measures which are destroying democracy and the rule of law
- Parallel to all these efforts, the Italian lawyer Dr. Renate Holzeisen is working with us and experts on a lawsuit against the EU Commission to have its approval of vaccines declared null & void – vaccines which are de facto untested and highly dangerous – in the case of the manufacturers Bioentech/Pfizer and Moderna, these are prohibited genetic experiments on humans. Meanwhile, the superbly versed and hard-hitting anti-Mafia public prosecutors are investigating the WHO and its Italian backers. In France work is progressing on a complaint to the Court for Human Rights.
- A German judge (who we are in contact with) has submitted a constitutional complaint against the blanket measures of the Federal Government, these measures undermining democracy and the rule of law; the hope here is that – notwithstanding all concrete appearances – the head of the Constitutional Court has retained his independence. We have published these constitutional complaints on our news website and they can be submitted by anyone.
https://2020news.de/wp-content/uploads/2020/12/Verfassungsbeschwerde-Richter-anonym-30122020.pdf
We shall continue to keep you up to date about the legal developments, including with vide os (although here there is a danger of them being removed from the platform). At the same time we must work on making the true facts known to as many people as possible. We will win because we must win.
Best regards
Dr. Reiner Fuellmich, LL.M.
- Attorney –
PS: With developments in the courts proceeding rapidly, and since we shall probably partic ipate with submissions of our own in at least one of the ongoing Anglo-American lawsuits, we intend in a fortnight to three week to conduct a Zoom conference for the clients we are representing; in this framework we shall discuss matters with some of the attorneys involved here and in the English-speaking countries and also with Professor Schwab; we shall also answer questions coming from the chat.
WOH!
U know all the speculation about what goodies the ~6" up the shnoz PCR test might be leaving behind (like, the MuhRONA itself?), besides the jeopardy of damage to the blood-brain barrier?
from 14:50 - 22m in this latest from Max today, woman (who suffers from Morgellon's) gets a couple of those tests & picks apart the "cotton" swab end, & finds they're actually 'living' Morgellon's nano-fibers -- she claims they're silver, not cotton! 42m:
BUCKLE UP! THE RIDE IS ABOUT TO BEGIN
Max's previous vid pub'd Jan 12, 36m:
The Covid Fraudemic - You Are the Resistance
The Same Playbook
There was a break-in of the Bundestag building in Berlin Germany on August 30, 2020, that happened at the time of huge, possibly million person, demonstration of the people against the Covid restrictions. The goal of this "storming" on the Bundestag appears to have been to draw attention away from the huge demonstration of the citizenry of Germany against the "Covid virus" restrictions on the people.
The January 6, 2021, entry of several "protesters" to the United States Capital building took place at the exact same time that congress was inside the same building about to hear testimony regarding the instances of massive voting irregularities and fraud related to the November 3, 2020 United States presidential election. The goal appears to have been to draw attention away from the strong evidence of vote fraud in several large U S cities.
The Bundestage parliament building probably is just a maximum security building as is also the United States capitol building in Washington D.C.
Same playbook.
Same fakery events.
Same paid crisis actor talent agency?
Same paymaster?
Same purpose.
Manipulate and control the populace to install a One World Death and Slavery System for All.
Use any old created atrocity -- virus, massive vote fraud etc -- as the tool to play out the problem / reaction /solution routine again and again.
_______________________________
https://www.dw.com/en/german-leaders...eps/a-54758246
News
German leaders slam extremists who rushed Reichstag steps
Politicians have hit out at extremists and corona-skeptics who attempted to enter Germany's parliament building after police shut down their demonstration. Hundreds of people were arrested.
https://static.dw.com/image/54755588_303.jpg
News
German leaders slam extremists who rushed Reichstag steps
Politicians have hit out at extremists and corona-skeptics who attempted to enter Germany's parliament building after police shut down their demonstration. Hundreds of people were arrested.
Deutschland Berlin Protest gegen Corona-Maßnahmen
German politicians on Sunday said they were outraged after several hundred people attempted to break into the Reichstag — the federal parliament building in Berlin — as part of a vast protest against the country's coronavirus restrictions.
President Frank-Walter Steinmeier described the incident as an "unbearable attack on the heart of our democracy."
On Saturday evening, hundreds of people tried to force their way into the building and were able to break through a security barrier and run up the stairs before being stopped by police.
Many of those involved sported clothing and flags associated with the far-right Reichsbürger movement, which denies the legitimacy of the modern German state.
'Extremist rabble'
Steinmeier labeled the trespassers a "right-wing extremist rabble," before paying tribute to security forces who he said had "acted extremely prudently in a difficult situation."
The incident took place after an estimated 38,000 people gathered in the German capital on Saturday to protest against the country's coronavirus policies.
After about two hours, police called off the protest, citing the disregarding of social distancing rules.
Reacting to the incident, Interior Minister Horst Seehofer told the newspaper Bild am Sonntag that: "The Reichstag building is the seat of our Parliament and thus the symbolic center of our liberal democracy."
"The fact that sowers of chaos and extremists are abusing it for their own purposes is unacceptable."
embedded video
Germany bans anti-Semitic 'Reich Citizens' group
News
German leaders slam extremists who rushed Reichstag steps
Politicians have hit out at extremists and corona-skeptics who attempted to enter Germany's parliament building after police shut down their demonstration. Hundreds of people were arrested.
Deutschland Berlin Protest gegen Corona-Maßnahmen
German politicians on Sunday said they were outraged after several hundred people attempted to break into the Reichstag — the federal parliament building in Berlin — as part of a vast protest against the country's coronavirus restrictions.
President Frank-Walter Steinmeier described the incident as an "unbearable attack on the heart of our democracy."
On Saturday evening, hundreds of people tried to force their way into the building and were able to break through a security barrier and run up the stairs before being stopped by police.
Many of those involved sported clothing and flags associated with the far-right Reichsbürger movement, which denies the legitimacy of the modern German state.
'Extremist rabble'
Steinmeier labeled the trespassers a "right-wing extremist rabble," before paying tribute to security forces who he said had "acted extremely prudently in a difficult situation."
The incident took place after an estimated 38,000 people gathered in the German capital on Saturday to protest against the country's coronavirus policies.
After about two hours, police called off the protest, citing the disregarding of social distancing rules.
Reacting to the incident, Interior Minister Horst Seehofer told the newspaper Bild am Sonntag that: "The Reichstag building is the seat of our Parliament and thus the symbolic center of our liberal democracy."
"The fact that sowers of chaos and extremists are abusing it for their own purposes is unacceptable."
Read more:Opinion: A coronavirus fiasco with one ray of hope
RANK
12:06 MIN.428 views
Sex and relationships during the COVID-19 pandemic
RANK
02:51 MIN.2.76K views
Coronavirus poses new dangers for sex workers
NEW
01:37 MIN.20 views
Getting vaccinated in England’s Salisbury Cathedral
HOT
04:44 MIN.156 views
Will Nord Stream 2 ever be completed?
HOT
04:13 MIN.108 views
New ideas for timeless shapes: Designer Stefan Diez
Germany bans anti-Semitic 'Reich Citizens' group
Nazi symbols 'have no place' near Parliament
Foreign Minister Heiko Maas tweeted: "It is shameful to have flags of the German Reich in front of Parliament."
______
Heiko Maas
����
@HeikoMaas
Alle haben Recht, über Umgang mit Corona zu streiten & natürlich für Ihre Meinung zu demonstrieren.
NIEMAND sollte dafür Rechtsextremen hinterherlaufen, PolizistInnen gefährden & viele einem Infektionsrisiko aussetzen.
Reichsflaggen vorm Parlament sind beschämend.
#Berlin2908
1:38 PM · Aug 29, 2020
5.3K
See the latest COVID-19 information on Twitter
______
News
German leaders slam extremists who rushed Reichstag steps
Politicians have hit out at extremists and corona-skeptics who attempted to enter Germany's parliament building after police shut down their demonstration. Hundreds of people were arrested.
Deutschland Berlin Protest gegen Corona-Maßnahmen
German politicians on Sunday said they were outraged after several hundred people attempted to break into the Reichstag — the federal parliament building in Berlin — as part of a vast protest against the country's coronavirus restrictions.
President Frank-Walter Steinmeier described the incident as an "unbearable attack on the heart of our democracy."
On Saturday evening, hundreds of people tried to force their way into the building and were able to break through a security barrier and run up the stairs before being stopped by police.
Many of those involved sported clothing and flags associated with the far-right Reichsbürger movement, which denies the legitimacy of the modern German state.
'Extremist rabble'
Steinmeier labeled the trespassers a "right-wing extremist rabble," before paying tribute to security forces who he said had "acted extremely prudently in a difficult situation."
The incident took place after an estimated 38,000 people gathered in the German capital on Saturday to protest against the country's coronavirus policies.
After about two hours, police called off the protest, citing the disregarding of social distancing rules.
Reacting to the incident, Interior Minister Horst Seehofer told the newspaper Bild am Sonntag that: "The Reichstag building is the seat of our Parliament and thus the symbolic center of our liberal democracy."
"The fact that sowers of chaos and extremists are abusing it for their own purposes is unacceptable."
Read more:Opinion: A coronavirus fiasco with one ray of hope
RANK
12:06 MIN.428 views
Sex and relationships during the COVID-19 pandemic
RANK
02:51 MIN.2.76K views
Coronavirus poses new dangers for sex workers
NEW
01:37 MIN.20 views
Getting vaccinated in England’s Salisbury Cathedral
HOT
04:44 MIN.156 views
Will Nord Stream 2 ever be completed?
HOT
04:13 MIN.108 views
New ideas for timeless shapes: Designer Stefan Diez
Germany bans anti-Semitic 'Reich Citizens' group
Nazi symbols 'have no place' near Parliament
Foreign Minister Heiko Maas tweeted: "It is shameful to have flags of the German Reich in front of Parliament."
"Nazi symbols and flags of the Reichsbürgers and of Imperial Germany have no place in the German Bundestag," wrote Finance Minister Olaf Scholz.
News
German leaders slam extremists who rushed Reichstag steps
Politicians have hit out at extremists and corona-skeptics who attempted to enter Germany's parliament building after police shut down their demonstration. Hundreds of people were arrested.
Deutschland Berlin Protest gegen Corona-Maßnahmen
German politicians on Sunday said they were outraged after several hundred people attempted to break into the Reichstag — the federal parliament building in Berlin — as part of a vast protest against the country's coronavirus restrictions.
President Frank-Walter Steinmeier described the incident as an "unbearable attack on the heart of our democracy."
On Saturday evening, hundreds of people tried to force their way into the building and were able to break through a security barrier and run up the stairs before being stopped by police.
Many of those involved sported clothing and flags associated with the far-right Reichsbürger movement, which denies the legitimacy of the modern German state.
'Extremist rabble'
Steinmeier labeled the trespassers a "right-wing extremist rabble," before paying tribute to security forces who he said had "acted extremely prudently in a difficult situation."
The incident took place after an estimated 38,000 people gathered in the German capital on Saturday to protest against the country's coronavirus policies.
After about two hours, police called off the protest, citing the disregarding of social distancing rules.
Reacting to the incident, Interior Minister Horst Seehofer told the newspaper Bild am Sonntag that: "The Reichstag building is the seat of our Parliament and thus the symbolic center of our liberal democracy."
"The fact that sowers of chaos and extremists are abusing it for their own purposes is unacceptable."
Read more:Opinion: A coronavirus fiasco with one ray of hope
RANK
12:06 MIN.428 views
Sex and relationships during the COVID-19 pandemic
RANK
02:51 MIN.2.76K views
Coronavirus poses new dangers for sex workers
NEW
01:37 MIN.20 views
Getting vaccinated in England’s Salisbury Cathedral
HOT
04:44 MIN.156 views
Will Nord Stream 2 ever be completed?
HOT
04:13 MIN.108 views
New ideas for timeless shapes: Designer Stefan Diez
Germany bans anti-Semitic 'Reich Citizens' group
Nazi symbols 'have no place' near Parliament
Foreign Minister Heiko Maas tweeted: "It is shameful to have flags of the German Reich in front of Parliament."
"Nazi symbols and flags of the Reichsbürgers and of Imperial Germany have no place in the German Bundestag," wrote Finance Minister Olaf Scholz.
"Participants in a demonstration that the AfD and NPD also helped mobilize tried to storm the Reichstag," parliamentarian for Germany's Green party Konstantin von Notz said, referring to two far-right parties in Germany.
"It is just disgusting and shameful," the politician said.
Vulnerable entry point targeted
Video of the event posted online showed a crowd of people standing outside the door of the Reichstag, where only three police officers blocked their entry.
Police were able to drive the crowd back with pepper spray and deescalate the situation. They then cleared the square in front of the Reichstag.
"We can't be everywhere all the time," Thilo Cablitz, a spokesman for the Berlin police, said. "This exact gap was sought out in an attempt to get around the barricade, to break through, and to get onto the steps of the Reichstag."
Authorities arrested around 300 people, according to Berlin state's Interior Minister Andreas Geisel. Around 200 of those were detained in front of the Russian embassy, where a crowd of some 3,000 Reichsbürger supporters and far-right extremists threw stones and bottles at police.
another embedded video
Berlin police break up protest against COVID-19 policy
United against a 'common enemy'
Secretary-General of the SPD Lars Klingbeil said he was surprised that Germany's domestic intelligence service had not received advanced warnings "that right-wing extremists were trying to infiltrate this demonstration."
"We will have to take a closer look at why these warnings were apparently not available in advance or were not properly evaluated," said the SPD politician said on the television show "BILD Live."
The Bundestag's advisory committee will now clarify "what security concepts looked like."
Speaking with DW, author and Internet activist Katharina Nocun said the diversity of the groups that participated in Saturday's demonstration is concerning.
"It is really hard to tell what this demonstration was really about because the organizers don't distance themselves from esoteric groups, from conspiracy theorists, from the far-right," she said. "They say, 'We have one common enemy, which is the government.'"
kp/mm (dpa, Reuters)
Read more:Opinion: A coronavirus fiasco with one ray of hope
Norway rushes to vaccinate and kill its nursing home residents and rushes to lie about the number of deaths and calms the public by telling them there is no causal relationship between the vaccine and the deaths.
https://www.bloomberg.com/news/artic...hs-and-vaccine
https://assets.bwbx.io/images/users/...v1/1000x-1.jpg
Until Friday, Norway had only used the Pfizer-BioNTech vaccine.
Photographer: Jean-Francois Monier/AFP/Getty Images
Health authorities in Norway sought to allay safety concerns raised by the death of some elderly patients after they were vaccinated against Covid-19, saying there’s no evidence of a direct link.
The initial reports from Norway raised alarm as the world looks for early signs of potential side effects from the vaccines. Although doctors say it’s possible that vaccine side-effects could aggravate underlying illnesses, they were expecting nursing-home residents to die shortly after being vaccinated because deaths are more common among the frailest and sickest elderly patients.
“Clearly, Covid-19 is far more dangerous to most patients than vaccination,” Steinar Madsen, medical director at the Norwegian Medicines Agency, said by phone on Monday, adding that a connection between the vaccine and the deaths is difficult to prove. “We are not alarmed.”
What to Know About Vaccine-Related Deaths, Allergies: QuickTake
In Norway, 33 people aged 75 and over died following immunization, according to the agency’s latest figures. All were already seriously ill, it said. The Scandinavian country has already inoculated almost all of its nursing home population, with more than 48,000 people vaccinated as of Monday afternoon.
The reported fatalities are well under 1 out of 1,000 nursing-home patients to be vaccinated, he said. The side effects of immunization can, in some cases, “tip the patients into a more serious course of the underlying disease,” Madsen said. “We can’t rule that out.”
Hong Kong Request
Other countries, including Germany and Israel, have also reported deaths in people who recently were vaccinated, without identifying causal links. Hong Kong’s government-appointed vaccine advisory panel said Monday that it’s seeking more data from the Norwegian and German governments on incidents involving the Pfizer-BioNTech shot, which has been approved in the territory.
Experts on vaccines and aging had predicted early on that deaths after vaccinations in high-risk patients might cause confusion.
“Frail, older adults die, and die often, and I don’t think people realize that,” said Keipp Talbot, an associate professor of medicine at Vanderbilt University who advises the U.S. Centers for Disease Control and Prevention on vaccine use. “My concern was that we would introduce vaccine, and people would think it was killing people.”
Talbot was the only person on the CDC advisory panel to recommend against offering Covid-19 vaccines first to old and sick people in nursing homes -- not because she was concerned they’d be harmed, she said, but because she was concerned that inevitable deaths shortly after shots would lower trust in the vaccines. Talbot said she also thought it might be a better use of scarce supplies to immunize the people surrounding the old and sick.
One key metric would be to compare the number of people who would typically die in a nursing home with the number who die shortly after getting a Covid vaccine, Talbot said.
Daily Deaths
“It is important to remember that about 45 people die every day in nursing homes in Norway, so it is not a given that this represents any excess mortality or that there is a causal connection,” Camilla Stoltenberg, head of the Norwegian Institute of Public Health, said at a press conference on Monday.
Until Friday, Norway had only used the vaccine provided by Pfizer Inc. and BioNTech SE. The companies are now working with the Nordic country to look into the deaths. The first Europe-wide safety report on the Pfizer-BioNTech vaccine is due to be published at the end of January.
What Bloomberg Intelligence Says...
“The concept of limiting Covid-19 vaccinations to those below 75 years of age isn’t supported by the U.S. data covering over 14 million people inoculated, our analysis shows, despite Norway reporting a much higher death rate after using the Pfizer-BioNTech vaccine. Norway’s excessive deaths suggest they are in subjects with serious, uncontrolled illnesses.”
-- Sam Fazeli, Bloomberg Intelligence Senior Industry Analyst
--Click here for the full report
Madsen said he isn’t expecting a different outcome with another vaccine, from Moderna Inc., which was introduced in Norway on Friday. Like the Pfizer-BioNTech shot, it uses messenger RNA technology that teaches the body’s cells to fight off infection.
The Norwegian Medicines Agency says it made clear before the vaccination program started that “it is expected that deaths will occur in a time-related context with vaccination” for the “oldest and sickest” people receiving inoculation.
— With assistance by Stephen Treloar
UP NEXT
Covid-19 Vaccine Deaths, Allergic Reactions: How Many Died in Norway?
https://www.bloomberg.com/news/artic...hs-and-vaccine
FYI
find a way to get ivermectin pills without a prescription, like maybe from Mexico and find out daily dose. This seems like an easy way to protect yourself and with almost no side effects. However, you will be helping satan if you buy anything from Amazon.
Amazon sells ivermectin pills for humans but looks like is prescription only from doctor to buy it.
I just heard guest on ACH show say taking ivermectin as prophylactic will absolutely prevent you from getting this "flu" and that you can take an aspirin a day to keep your blood flowing freely. Problem solved.
https://cldup.com/0LFAarflqG.mp3 about at 37 minutes
https://www.amazon.com/s?k=ivremectin&ref=nb_sb_noss
Showing results for ivermectin
Search instead for ivremectin
Prescription Required
Ivermectin (Generic for Soolantra, Topical Cream)
Ivermectin (Topical Cream, Generic for Soolantra)
Pay with insurance
$-- View copay price in cart
Or pay without insurance. Price is $677.25. Join Prime and save 22%.
Amazon Pharmacy FREE delivery
FSA or HSA eligible
Prescription Required
Ivermectin (Generic for Stromectol, Oral Tablet)
Ivermectin (Oral Tablet, Generic for Stromectol)
Pay with insurance
$-- View copay price in cart
Or pay without insurance. Price is $53.34.
Amazon Pharmacy FREE delivery
FSA or HSA eligible
Prescription Required
Soolantra (Brand for Ivermectin, Topical Cream)
Soolantra (Topical Cream, Brand for Ivermectin)
Pay with insurance
$-- View copay price in cart
Or pay without insurance. Price is $482.40. Join Prime and save 28%.
Amazon Pharmacy FREE delivery
FSA or HSA eligible
Prescription Required
Stromectol (Brand for Ivermectin, Oral Tablet)
Stromectol (Oral Tablet, Brand for Ivermectin)
Pay with insurance
$-- View copay price in cart
Or pay without insurance. Price is $128.40. Join Prime and save 26%.
Amazon Pharmacy FREE delivery
FSA or HSA eligible
Durvet Ivermectin Paste Equine Dewormer - 3 Pack
Durvet Ivermectin Paste Equine Dewormer - 3 Pack
4.7 out of 5 stars 1,374
$19.53-
$138.95
FREE Shipping on eligible orders
can buy over the counter ivermectin as a paste or an injection for farm animals as a dewormer without a prescription.
https://static-3.bitchute.com/live/c...4r_640x360.jpg
https://www.bitchute.com/video/9g3wHSik4g4r/
56:08 video runtime
Dr. Simone Gold - The truth about the CV19 vaccine
AWESOME presentation by the brilliant Dr. Simone Gold of "America's Frontline Doctors" who was fired from her job as a result of standing up for the truth of the CV19 "pandemic" and the injections that they're trying to sell as "vaccines."
Sign the petition by "Stop Medical Discrimination" here:
https://stopmedicaldiscrimination.org/
https://www.americasfrontlinedoctors.com/
So far still up at: https://www.youtube.com/watch?v=xFnt...ature=youtu.be (56:08)
https://www.trunews.com/stream/trune...anuary-18-2021
JANUARY 18, 2021 CORONAVIRIS REPORT FROM TruNews.com
14:08 video runtime
SnifferJoe surfaces to contribute his usual embarrassment at 01:41.
TruNews Headlines with Kerry Kinsey - January 18, 2021
55 people in the US have died after getting the COVID-19 vaccine, that according to reports submitted to a federal database, the Vaccine Adverse Event Reporting System, Del Bigtree says,‘We are rolling out an untested vaccine; I believe there is going to be mass carnage,’ California officials call for a pause on specific Moderna vaccines due to allergic reactions, a priest prepares his congregation for the upcoming Biden years; ‘We are in for it, folks’ 33 people have died in Norway from taking the vaccine, and on "Corona Crazy’ see how Italians start singing “freedom” and refuse police orders to leave a restaurant, and a timely prayer request for a man’s grandparents who are considering getting the vaccine.
https://www.trunews.com/stream/trune...anuary-19-2021
TruNews Corona Report for Tuesday, January 19, 2021
15:07 video runtime
includes clip from new movie PLANET LOCKDOWN
https://twitter.com/vegsource/status...49847629770753
Jeff Nelson
@vegsource
Covid is a true killer. So far it’s killed the flu, cancer, heart disease - it killed the ability to think, logic & common sense. It killed the economy, the working class, & millions of jobs. It killed millions of businesses, human connection, love and compassion.
5:35 PM • Jan 17, 2021•Twitter for iPhone
42.8K
Retweets
2.5K
Quote Tweets
113K
Likes
https://www.trunews.com/stream/trune...anuary-20-2021
TruNews Corona Report for January 20, 2021
13:31 video runtime
05:25 to 12:05 Corona Report
Another clip from movie, Planet Lockdown.
PlanetLockdownfilm.com
https://www.planetlockdownfilm.com/
PLANET LOCKDOWN
HAVING THE COURAGE TO FACE OUR FEARS
A DOCUMENTARY AND INTERVIEW SERIES ON OUR CURRENT SITUATION.
FULL INTERVIEWS TELL THE COMPLETE STORY
FULL LENGTH DOCUMENTARY COMING MID FEBRUARY
DONATE HERE
SIGN UP FOR UPDATES ON THE PROJECT HERE
embedded video
https://in-this-together.com/covid-1...-global-fraud/
COVID 19 – Evidence Of Global Fraud
TOPICS:covid 19crimefraudpandemicsars-cov-2
https://itt002-itt.netdna-ssl.com/wp...01.jpeg?x56485
Posted By: Iain November 16, 2020
COVID 19, and the subsequent governmental responses, appear to be part of an international conspiracy to commit fraud. It seems there is no evidence that a virus called SARS-CoV-2 causes a disease called COVID 19.
Sometimes you have to go with your gut. I am not an expert in genetics and, as ever, stand to be corrected. However my attention was drawn to some research published by the Spanish medical journal D-Salud-Discovery. Their advisory board of eminently qualified physicians and scientists lends further credibility to their research. Their claim is astounding.
The genetic primers and probes used in RT-PCR tests to identify SARS-CoV-2 do not target anything specific. I followed the search techniques outlined in this English translation of their report and can corroborate the accuracy of their claims about the nucleotide sequences listed in the World Health Organisations protocols. You can do the same.
D-Salud-Discovery state there are no tests capable of identifying SARS-CoV-2. Consequently all claims about the alleged impact of COVID 19 on population health are groundless.
The entire official COVID 19 narrative is a deception. Ostensibly, there is no scientific foundation for any part of it.
If these claims are accurate we can state that there is no evidence of a pandemic, merely the illusion of one. We have suffered incalculable loss for no evident reason, other than the ambitions of unscrupulous despots who wish to transform the global economy and our society to suit their purposes.
In doing so this “parasite class” have potentially committed countless crimes. These crimes can and should be investigated and prosecuted in a court of law.
Identification of What Exactly?
The World Health Organisation (WHO) classified COVID-19 (COronaVIrus Disease 2019). They declared a global COVID 19 pandemic on March 11th 2020.
The WHO’s Laboratory testing guidance states:
“The etiologic agent [causation for the disease] responsible for the cluster of pneumonia cases in Wuhan has been identified as a novel betacoronavirus, (in the same family as SARS-CoV and MERS-CoV) via next generation sequencing (NGS) from cultured virus or directly from samples received from several pneumonia patients.”
The WHO’s claim is that the SARS-CoV-2 virus causes the disease COVID-19. They also allege this virus has been clearly identified by researchers in Wuhan.
In the WHO’s Novel Coronavirus 2019-nCov Situation Report 1, they state:
“The Chinese authorities identified a new type of coronavirus, which was isolated on 7 January 2020……On 12 January 2020, China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”
These two statements from the WHO clearly suggest the SARS-CoV-2 virus was isolated (meaning purified for study) and then genetic sequences were identified from the isolated sample. From this, diagnostic kits were developed and distributed globally to test for the virus in towns, cities and communities around the world. According to the WHO and Chinese researchers, these tests will find the virus that causes COVID 19.
Yet the WHO also state:
“Working directly from sequence information, the team developed a series of genetic amplification (PCR) assays used by laboratories.”
The Wuhan scientists developed their genetic amplification assays from “sequence information” because there was no isolated, purified sample of the so called SARS-CoV-2 virus. They also showed electron microscope images of the newly discovered virions (the spiky protein ball containing the viral RNA.)
However, such protein structures are not unique. They look just like other round vesicles, such as endocytic vesicles and exosomes.
Virologists claim that it is not possible to “isolate” a virus because they only replicate inside host cells. They add that Koch’s postulates do not apply because they relate to bacteria (which are living organisms). Instead, virologists observe the virus’ cytopathogenic effects (CPE), causing cell mutation and degradation, in cell cultures.
When Chinese researchers first sequenced the full SARS-CoV-2 genome they observed CPE in Vero E6 and Huh7 cells. Vero E6 are an immortalised monkey cell line and Huh7 are immortalised cancer (tumorigenic) cells. Meaning they have been maintained in vitro (in petri dish cultures) for many years.
Central to the official SARS-CoV-2 story is the idea that it is a zoonotic virus, capable of bridging the species gap from animals to humans. When scientists from the U.S. CDC “infected” various cells with the novel virus they noted the following:
“We examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549) [lung celles], human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81 [monkey cells]……No cytopathic effect was observed in any of the cell lines except in Vero cells [monkey cells]…….HUH7.0 and 293T cells showed only modest viral replication and A549 cells [human lung tissue cells] were incompatible with SARS-CoV-2 infection.”
The CDC did not observe any CPE in human cells. They saw no evidence that this alleged virus caused any human illness. Nor did this supposed human virus show any notable replication in human cells, suggesting human to human infection would be impossible.
It is not clear that SARS-CoV-2 is a human virus capable of causing widespread illness. It may not even physically exist. Is it nothing more than a concept based upon predictive genetic sequences?
Voyage Of Discovery
The Wuhan Center for Disease Control and Prevention and the Shanghai Public Health Clinical Centre published the first full SARS-CoV-2 genome (MN908947.1 ). This has been updated many times. However, MN908947.1 was the first genetic sequence describing the alleged COVID 19 etiologic agent (SARS-CoV-2).
All subsequent claims, tests, treatments, statistics, vaccine development and resultant policies are based upon this sequence. If the tests for this novel virus don’t identify anything capable of causing illness in human beings, the whole COVID 19 narrative is nothing but a charade.
The WUHAN researchers stated that they had effectively pieced the SARS-CoV-2 genetic sequence together by matching fragments found in samples with other, previously discovered, genetic sequences. From the gathered material they found an 87.1% match with SARS coronavirus (SARS-Cov). They used de novo assembly and targeted PCR and found 29,891-base-pair which shared a 79.6% sequence match to SARS-CoV.
They had to use de novo assembly because they had no priori knowledge of the correct sequence or order of those fragments. Quite simply, the WHO’s statement that Chinese researchers isolated the virus on the 7th January is false.
The Wuhan team used 40 rounds of RT-qPCR amplification to match fragments of cDNA (complimentary DNA constructed from sampled RNA fragments) with the published SARS coronavirus genome (SARS-CoV). Unfortunately it isn’t clear how accurate the original SARS-CoV genome is either.
In 2003 a team of researchers from from Hong Kong studied 50 patients with severe acute respiratory syndrome (SARS). They took samples from 2 of these patients and developed a culture in fetal monkey liver cells.
They created 30 clones of the genetic material they found. Unable to find evidence of any other known virus, in just one of these cloned samples they found genetic sequences of “unkown origin.”
E Gene target sequence
Examining these unknown RNA sequences they found 57% match to bovine coronavirus and murine hepatitis virus and deduced it was of the family Coronaviridae. Considering these sequences to suggest a newly discovered SARS-CoV virus (new discoveries being ambrosia for scientists), they designed RT-PCR primers to test for this novel virus. The researchers stated:
“Primers for detecting the new virus were designed for RT-PCR detection of this human pneumonia-associated coronavirus genome in clinical samples. Of the 44 nasopharyngeal samples available from the 50 SARS patients, 22 had evidence of human pneumonia-associated coronavirus RNA.”
Half of the tested patients, who all had the same symptoms, tested positive for this new alleged virus. No one knows why the other half tested negative for this novel SARS-CoV virus. The question wasn’t asked.
This supposed virus had just a 57% sequence match to allegedly known coronavirus. The other 43% was just “there.” Sequenced data was produced and recorded as a new genome as GenBank Accession No. AY274119.
The Wuhan researchers subsequently found an 79.6% sequence match to AY274119 and therefore called it a novel strain of SARS-CoV (2019-nCoV – eventually renamed SARS-CoV-2). No one, at any stage of this process, had produced any isolated, purified sample of any virus. All they had were percentage sequence matches to other percentage sequence matches.
Isolate Nothing
Scientists are very annoyed because they keep saying the virus has been isolated but no one believes them. This is because, as yet, no one has provided a single purified sample of the SARS-CoV-2 virus. What we have instead is a completed genome and, as we are about to discover, it isn’t particularly convincing.
Investigative journalists Torsten Engelbrecht and Konstantin Demeter asked some of the scientists who said they had images of SARS-C0V-2 virions to confirm these were images of an isolated, purified, virus. None of them could.
In Australia scientists from the Doherty Institute, announced that they had isolated the SARS-CoV-2 virus. When asked to clarify the scientists said:
“We have short (RNA) sequences from the diagnostic test that can be used in the diagnostic tests”
This explains why the Australian government state:
“The reliability of COVID-19 tests is uncertain due to the limited evidence base…There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”
In The UK, in July, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in which they asked him to:
“Produce independently peer reviewed scientific evidence proving that the Covid-19 virus has been isolated.”
To date they have not received a reply.
Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England (PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus. To which they responded:
“PHE can confirm it does not hold information in the way suggested by your request.”
Canadian researcher Christine Massey made a similar freedom of information request, asking the Canadian government the same. To which the Canadian government replied:
“Having completed a thorough search, we regret to inform you that we were unable to locate any records responsive to your request.”
In the U.S. the Centre For Disease Control (CDC) RT-PCR Diagnostic Panel state:
“…No quantified virus isolates of the 2019-nCoV are currently available……..Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.”
Last updated on 13th July 2020, the CDC are yet to obtain any pure viral sample from any patient said to have the disease of COVID-19. They openly admit their tests don’t necessarily show if SARS-CoV-2 is either present or causes COVID 19.
We are told that none of this matters. That we are ignorant and just don’t understand virology. Therefore, we must except pictures of things we know could be something else and genetic sequences (which could be anything else) as conclusive proof that this virus, and the disease it is supposed to cause, are real.
Testing For Nothing
The WHO, and every government, think tank, policy steering committee, government scientific advisor, supranational institutions and others who promote the official COVID 19 narrative, assert that SARS-CoV-2 causes COVID 19. While no one has ever produced a sample of this supposed virus, the alleged SARS-CoV-2 genome has been published. It is in the public domain.
Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to identify the presence of the “virus”. These include:
RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of COVID 19 diseased epithelial cells.
S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.
E gene (Orf1ab) – small membrane protein used in viral assembly
N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation
The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)
The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers.
It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in a sample.
Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore we can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences.
The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.
The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.
However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.
Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.
Whenever we check the so called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.
So called fact checkers, like Reuters’ Health Feedback project, have been quick to dismiss the claims of those who have noticed the apparent lack of specificity in the supposed SARS-CoV-2 genome. Using a slew of strawman arguments like, “this claim suggests every test should be positive,” (which it doesn’t) their debunking attempt runs something like this:
Primers are designed to bind to specific nucleotide sequences that are unique to the virus. The forward primer may bind to a particular chromosome but the reverse primer doesn’t bind to the same chromosome and so the chromosome is not present in the SARS-CoV-2 virus. Moreover because the forward and reverse primers envelop the sequence to be amplified the cDMA sequence between primers is unique to the virus.
This seems to deliberately misrepresent the significance of these findings by forwarding an argument that no one, other than the fact checkers themselves, are making. BLAST searches show that these target sequences are not unique to SARS-CoV-2. Nor do all targets need to be found for a result to be deemed positive.
Moroccan researchers investigated the epidemiology of Moroccan alleged cases of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As we have just discussed, many may have been positive for none.
This is entirely in keeping with WHO’s test guidelines. They state:
“An optimal diagnosis consists of a NAAT [nucleic acid amplification test] with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used……One or more negative results do not necessarily rule out the SARS-CoV-2 infection.”
Regardless of the spurious arguments of well funded fact checkers, if the forward and reverse primers identify junk, perhaps one being the fragment of a chromosome and the other a microbial sequence, then the amplified region between them is probably junk too.
The argument that RT-PCR only finds RNA is specious. Natural transcription (the separation of DNA strands) occurs during gene expression. No one is saying whole chromosomes or microbes are sequenced in the alleged SARS-CoV-2 genome. Though they may, for all we know. They are saying the alleged markers, used to test for this supposed virus, are not fit for purpose.
RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called “junk,” DNA (cDNA.)
For example the SARS-CoV-2 S gene is meant to be highly specific to the SARS-CoV-2 virus genome. The target sequence is – TTGGCAAAATTCAAGACTCACTTTC. A microbial BLAST search returns 97 microbial matches with 100% identity sequence match. The lowest identity percentage match, within the top 100, is 95%. A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments.
No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO’s test protocols that clearly identifies what it is. The whole genome could be false. The tests do not prove the existence of SARS-CoV-2. All they reveal is a soup of unspecified genetic material.
If so, as there are no isolates or purified samples of the virus, without a viable test, there is no evidence that SARS-CoV-2 exists. Therefore, nor is there any evidence that a disease called COVID 19 exists.
This infers that there is no scientific basis for any claims about COVID 19 case numbers, hospital admissions or mortality figures. All measures taken to combat this deadly virus are quite possibly founded upon nothing.
Conclusive Fraud
Fraud is a criminal act. The legal definition of fraud is:
“Some deceitful practice or willful device, resorted to with intent to deprive another of his right, or in some manner to do him an injury.”
The Legal definition of a conspiracy is:
“A combination or confederacy between two or more persons formed for the purpose of committing, by their joint efforts, some unlawful or criminal act”
It seems, those who claim we face a pandemic have not provided any evidence to show that a virus called SARS-CoV-2 causes a disease called COVID 19. All of the information strongly suggesting this possibility is readily available in the public domain. Anyone can read it.
For there to be a fraud the deceit must be wilful. The intention must be to deliberately deprive others of their rights or injure them in some other way. If there is evidence of collusion between individuals ad/or organisations to commit fraud, then this is a conspiracy (in Common Law jurisdictions) or a Joint Criminal Enterprise (JCE) under International Law.
It seems COVID 19 has been deliberately used as a casus belli to wage war on humanity. We have been imprisoned in our own homes, our freedom to roam restricted, freedom of speech and expression eroded, rights to protest curtailed, separated from loved ones, our businesses destroyed, psychologically bombarded, muzzled and terrorised .
Prince Charles telling us to embrace the Great Reset
Worse still, while there is no evidence of unprecedented all cause mortality, there were unseasonable spikes in deaths. These correlate precisely with Lockdown measures which saw the withdrawal of the health services we pay for and a reorientation of public health services to treat one alleged disease at the exclusion of all others.
Further, it is proposed by those who have forwarded the COVID 19 story, that this alleged disease provides justification for the complete restructuring of the global economy, our political systems, societies, cultures and humanity itself.
To be allowed to participate in their so called “new normal,” which is the wholesale transformation of our entire society without our consent, they insist we submit to their conditions.
These include, but aren’t limited to, bio-metric surveillance of everyone, the centralised control and monitoring of all of our transactions, oppressive business and social restrictions and an effective demand that we have no right to sovereignty over our own bodies. This constitutes the condition of slavery.
There is no doubt that we have been deprived of our rights and injured. In Common Law jurisdictions innocence is presumed, but the evidence that harm has been deliberately caused by an international conspiracy is overwhelming. Destructive policies, enacted by governments across the world, clearly originated among globalist think tanks and supranational institutions long before the emergence of this non existent pandemic.
In Napoleonic Code jurisdictions, guilt is presumed. In order for the accused conspirators to prove their innocent they must show that, despite their immeasurable resources, they have collectively been unable to access or understand any of the freely available evidence suggesting COVID 19 is a myth.
Those responsible for the crime of conspiracy to commit global fraud should be tried. If found guilty they should be imprisoned while the rest of us get on with trying to repair the damage they have already inflicted.
https://www.bitchute.com/static/v129...lay-button.png
Need to Know: The Fetzer Report Episode 112 - 19 January 2021
Watch
https://www.bitchute.com/video/mKgzXIikWGeJ/
1:01:58 video runtime
virus / vaccine part of this video
begins at 28:04
and ends at 40:47
https://www.youtube.com/watch?v=cbveErE7pjM
Tucker Carlson Tonight 1/21/21 FULL | FOX BREAKING NEWS January 21 ,21
14,749 views
Tucker said.. in first minute of this scathing negative criticism of Biden's first day in office.
"CNN can go ahead and take that Covid death ticker off the screen. There's no need for it now. It's not like you can blame Joe Biden for some virus that escaped from a Chinese lab in Wuhan. That wouldn't be fair. Come on now. CNN dutifully removed it this morning.
Covid deaths ? ! Settle down, America, it's just a bad flu season.
Joe Biden apparently agrees. Joe Biden and his family appeared last night without their masks. Biden explained "we're celebrating a historic day in our country. We have bigger things to worry about."
•Premiered 3 hours ago
809
75
Share
Save
Taylor Gacha
Tucker Carlson Tonight 1/21/21
Like and subscribe channel
Thank all For watching…
_______________
Very odd things going on with Fox News for January 21, including Tucker Carlson show, Lou Dobbs show and Hannity show.
All extremely negative against Biden.
Something big is cooking and many games behind the scenes.
_______________________
https://www.youtube.com/watch?v=O_HL16sxpfw
Lou Dobbs Tonight 1/21/21 FULL | Fox BREAKING TRUMP NEWS January 21, 21
86,873 views
•Jan 21, 2021
2.1K206Share
Save
Taylor Gacha
Lou Dobbs 1/21/21 Get a breakdown of the day’s top stories and how they iact the economy! Like and subscribe channel Thank all For watching….
_____________
https://www.youtube.com/watch?v=UMLnHlBe-ic
___________________
https://www.youtube.com/watch?v=_xnlpOPhyJ
Tucker Carlson Tonight 1/21/21 | FOX BREAKING NEWS January 21 ,21
29,365 views
•Premiered 2 hours ago
3.7K473ShareSave
Taylor Gacha
Tucker Carlson Tonight 1/21/21 Like and subscribe channel Thank all For watching…
Thisa one was erased by YouTube but dublicate is above.
Taylor Gotch channel uperimposes on his thumnails photos of his videos of Joe and Nancy in orange prison uniforms.
Now that the communists have successfully installed the commander-and-thief, the MSM coronavirus and vaccine propaganda will starkly change. No more concern for rule of law and justice in doing their crimes against humanity as those things no longer exist.
The absurd level of lies and propaganda from the media promoting the "virus" and the "vaccine" is no longer necessary.
It is understood that our unitary totalitarian NewState operates, by default, in lying, cheating and stealing.
"The coronavirus pandemic will “fade away” even without a vaccine"
President Donald Trump
Trump said this?Quote:
Originally Posted by Dachsie
https://www.mostholyfamilymonastery....he-marines.jpg
Biden breaks his own "law" shortly after mandating that all must wear face masks when on federal property
https://www.mostholyfamilymonastery....l-property.jpg
https://twitter.com/charliekirk11/st...al-property%2F
Charlie Kirk
@charliekirk11
·
Jan 20
Does Joe Biden’s new executive order mandating masks on federal property not apply to Joe Biden while he’s on federal property?
Because here he is at the Lincoln Memorial with no mask just hours after signing it.
Charlie Kirk
@charliekirk11
·
Jan 20
Does Joe Biden’s new executive order mandating masks on federal property not apply to Joe Biden while he’s on federal property?
Because here he is at the Lincoln Memorial with no mask just hours after signing it.
embedded video on twitter
https://www.bitchute.com/video/hAEq4ekmxcCT/
I DO NOT COMPLY!
Watch
https://static-3.bitchute.com/live/c...CT_640x360.jpg
Jan 22, 2021
I DO NOT COMPLY!
Trailer for the I DO NOT COMPLY Campaign - a grassroots, global movement. It is a campaign dedicated to sharing the stories of people all around the world who will no longer accept the tyrannical Covid-19 regulations and mandates that seek to remake our societies and strip us of our freedoms. It is also a pledge and an oath of resistance. We hereby declare that WE ARE DONE BEING COMPLIANT. We are done being silent.
https://www.youtube.com/watch?v=V_cT...ature=emb_logo (3:38)
3:38 video runtime
https://www.wsls.com/news/2021/01/22...on-dies-at-86/
Baseball legend, former home run king Henry ‘Hank’ Aaron dies at 86
Aaron hit 755 career home runs, holding the record for 33 years
Baseball Hall of Famer Hank Aaron has died.
WSB-TV in Atlanta reports that the one-time home run king died on Friday morning, according to his daughter.
Aaron, who was inducted into the hall of fame in 1982, played 23 MLB seasons, from 1954 to 1976.
In that time, he hit 755 home runs, a record he held for 33 years until it was broken by Barry Bonds.
The 25-time All-Star was also a three-time Gold Glove winner and won one World Series in 1957 with the Milwaukee Braves.
A cause of death has not yet been release for Aaron.
[IMG]https://pbs.twimg.com/card_img/13516...jpg&name=small[/IMG]
Hank Aaron
@HenryLouisAaron
·
Jan 5
I was proud to get the COVID-19 vaccine earlier today at Morehouse School of Medicine. I hope you do the same!
A few weeks ago, he did receive the COVID-19 vaccine (on January 6, 2021) .
https://encrypted-tbn3.gstatic.com/s...q-n3Y&usqp=CAc
https://www.trunews.com/stream/trune...anuary-22-2021
04:40 to 09:40 Corona Report part of this 13:51 video runtime
Inspiring message from Dale Bigtree
An embarrassing misspeak from Chucky "Israel First" Schumer
Mariocopa county store owner confronts mask wearer on his store's "mask free Friday" rule. Needs to pull gun on contrarian customer.
Good show
WHO Releases New COVID Test Guidelines To Greatly Reduce Case Numbers And Make It Appear Vaccines Are Working
JANUARY 22, 2021 By CFT TEAM 3 COMMENTS
https://christiansfortruth.com/wp-co...covid-test.jpg
In what some have suggested is politicized timing, the World Health Organization on Wednesday changed the protocol for COVID-19 tests, which will result in large reductions in the numbers of positive cases — which will then be held up as “proof” that the highly publicized vaccines have helped end the “pandemic”:
The body took this action just one hour after Joe Biden was sworn in as president of the United States.We’ve been predicting for the last 8 months that this is exactly what they would do in order to “end the pandemic” — change the cycling threshold for the PCR test, which would automatically eliminate all the false positives.
On Wednesday, the World Health Organization (WHO) issued guidance regarding the polymerase chain reaction (PCR) test, which is being widely used across the globe in order to detect cases of COVID-19. In a short information notice, the WHO referred back to an instruction booklet for COVID testing, released in September 2020, noting that “careful interpretation of weak positive results is needed.”
The guidance warned against diagnosing someone as having the virus just because he tests positive if he does not present with symptoms of COVID-19.
It also warned about the high risk of false positives: “The cycle threshold (Ct) needed to detect virus is inversely proportional to the patient’s viral load. Where test results do not correspond with the clinical presentation, a new specimen should be taken and retested using the same or different NAT technology.”
“As disease prevalence decreases, the risk of false positive increases. The probability that a person who has a positive result (SARS-CoV-2 detected) is truly infected with SARS-CoV-2 decreases as prevalence decreases, irrespective of the claimed specificity,” the WHO continued.
An even more surprising admission followed: the document described PCR tests merely as an “aid for diagnosis” and did not place any greater weight upon the results of PCR tests. “Most PCR assays are indicated as an aid for diagnosis, therefore, health care providers must consider any result in combination with timing of sampling, specimen type, assay specifics, clinical observations, patient history, confirmed status of any contacts, and epidemiological information.”
The new guidance for assessing the results of PCR COVID tests effectively means that there are additional steps to be taken before reporting that someone has tested positive for the virus. The WHO notes that “a new specimen should be taken and retested” and further stipulates that “health care” workers should weigh up the test result alongside real-world information, such as symptoms or “clinical observations,” and contact with any other infected individuals.
And that’s why they chose the PCR “test” from the very beginning — because it is not really a diagnostic “test” at all, but a laboratory method for studying small fragments of DNA.
Now that it’s done what it was supposed to do — create the illusion of a pandemic — the PCR can be demoted from the “gold standard” of COVID tests to a mere “diagnostic aid” that should be confirmed when the patient presents actual physical symptoms.
By making these new recommendations, the WHO is essentially signaling that the first phase of “pandemic” is over — and we will now see more and more stories of infection rates slowly declining, as Israel has begun doing — as more and more people are vaccinated with the worthless and dangerous “vaccines”.
But remember — Anthony Fauci himself proclaimed that these COVID vaccines won’t stop you from “contracting” the virus — it will only help lessen the severity of the “disease” if you become symptomatic.
In that sense, we should see no decline in “infection” rates — or case numbers — in the wake of the vaccine roll out.
But we will see a decline in case numbers because of these new WHO’s recommendations for changes in the PCR test standards — which will be used to “prove” the vaccines now magically do “block” new infections.
But we will all still have to wear useless masks and social distance because — well — just because.
https://christiansfortruth.com/who-r...s-are-working/
https://www.who.int/news/item/20-01-...-users-2020-05
WHO Information Notice for IVD Users 2020/05
Home/
News/
WHO Information Notice for IVD Users 2020/05
WHO Information Notice for IVD Users 2020/05
Nucleic acid testing (NAT) technologies that use polymerase chain reaction (PCR) for detection of SARS-CoV-2
20 January 2021 Medical product alert
Geneva
Reading time: 1 min (370 words)
AddThis Sharing Buttons
Share to Print
Share to Email
Share to Facebook
Share to Twitter
Share to More
العربية
中文
Français
Русский
Español
Português
Product type: Nucleic acid testing (NAT) technologies that use polymerase chain reaction (PCR) for detection of SARS-CoV-2
Date: 13 January 2021
WHO-identifier: 2020/5, version 2
Target audience: laboratory professionals and users of IVDs.
Purpose of this notice: clarify information previously provided by WHO. This notice supersedes WHO Information Notice for In Vitro Diagnostic Medical Device (IVD) Users 2020/05 version 1, issued 14 December 2020.
Description of the problem: WHO requests users to follow the instructions for use (IFU) when interpreting results for specimens tested using PCR methodology.
Users of IVDs must read and follow the IFU carefully to determine if manual adjustment of the PCR positivity threshold is recommended by the manufacturer.
WHO guidance Diagnostic testing for SARS-CoV-2 states that careful interpretation of weak positive results is needed (1). The cycle threshold (Ct) needed to detect virus is inversely proportional to the patient’s viral load. Where test results do not correspond with the clinical presentation, a new specimen should be taken and retested using the same or different NAT technology.
WHO reminds IVD users that disease prevalence alters the predictive value of test results; as disease prevalence decreases, the risk of false positive increases (2). This means that the probability that a person who has a positive result (SARS-CoV-2 detected) is truly infected with SARS-CoV-2 decreases as prevalence decreases, irrespective of the claimed specificity.
Most PCR assays are indicated as an aid for diagnosis, therefore, health care providers must consider any result in combination with timing of sampling, specimen type, assay specifics, clinical observations, patient history, confirmed status of any contacts, and epidemiological information.
Actions to be taken by IVD users:
Please read carefully the IFU in its entirety.
Contact your local representative if there is any aspect of the IFU that is unclear to you.
Check the IFU for each incoming consignment to detect any changes to the IFU.
Provide the Ct value in the report to the requesting health care provider.
Contact person for further information:
Anita SANDS, Regulation and Prequalification, World Health Organization, e-mail: rapidalert@who.int
References:
1. Diagnostic testing for SARS-CoV-2. Geneva: World Health Organization; 2020, WHO reference number WHO/2019-nCoV/laboratory/2020.6.
2. Altman DG, Bland JM. Diagnostic tests 2: Predictive values. BMJ. 1994 Jul 9;309(6947):102. doi: 10.1136/bmj.309.6947.102.
____________________________
https://principia-scientific.com/who...has-a-problem/
WHO Finally Admits COVID19 PCR Test Has a ‘Problem’
Published on December 17, 2020
Written by John O'Sullivan
https://i2.wp.com/principia-scientif...50%2C370&ssl=1
In a statement released on December 14, 2020 the World Health Organization finally owned up to what 100,000’s of doctors and medical professionals have been saying for months: the PCR test used to diagnose COVID-19 is a hit and miss process with way too many false positives.
This WHO-admitted “Problem” comes in the wake of international lawsuits exposing the incompetence and malfeasance of public health officials and policymakers for reliance on a diagnostic test not fit for purpose.
This World Health Organization admission is that the crux of the “problem” is a wholly arbitrary cycling process which “means that many cycles were required to detect virus. In some circumstances, the distinction between background noise and actual presence of the target virus is difficult to ascertain.” [emphasis added]
The UN body is now clearly looking to distance itself from the fatally flawed test as a growing number of lawsuits are processing through the courts exposing the insanity of relying on a test that even the inventor, Professor Kary B. Mullis said was never designed to diagnose diseases. [1]
https://i1.wp.com/principia-scientif...pg?w=536&ssl=1
Professor Mullis was awarded the Nobel Prize in Chemistry in 1993. ‘Coincidentally’, Mullis died just before the pandemic started.
We reported on November 22, 2020 that a landmark court case in Portugal had ruled that the polymerase chain reaction test (PCR) used worldwide to diagnose COVID-19 was not fit for purpose. Most importantly, the judges ruled that a single positive PCR test cannot be used as an effective diagnosis of infection.
As Off-Guardian.org reported at the time:
“In their ruling, judges Margarida Ramos de Almeida and Ana Paramés referred to several scientific studies. Most notably this study by Jaafar et al., which found that – when running PCR tests with 35 cycles or more – the accuracy dropped to 3%, meaning up to 97% of positive results could be false positives.
The ruling goes on to conclude that, based on the science they read, any PCR test using over 25 cycles is totally unreliable. Governments and private labs have been very tight-lipped about the exact number of cycles they run when PCR testing, but it is known to sometimes be as high as 45. Even fearmonger-in-chief Anthony Fauci has publicly stated anything over 35 is totally unusable.”
You can read the complete ruling in the original Portuguese here, and translated into English here.
Among thousands of angry doctors arguing PCR tests should not be used is Dr. Pascal Sacré. He wrote that:
“This misuse of RT-PCR technique is used as a relentless and intentional strategy by some governments, supported by scientific safety councils and by the dominant media, to justify excessive measures such as the violation of a large number of constitutional rights, the destruction of the economy with the bankruptcy of entire active sectors of society, the degradation of living conditions for a large number of ordinary citizens, under the pretext of a pandemic based on a number of positive RT-PCR tests, and not on a real number of patients.”
Clear and conclusive scientific evidence proves that these tests are not accurate and create a statistically significant percentage of false positives. Positive results more likely indicate “ordinary respiratory diseases like the common cold.” [2]
https://i2.wp.com/principia-scientif...50%2C498&ssl=1
However, none of this is new information to science. These facts were known at least before 2007 after a New York Times report entitled, “Faith in Quick Test Leads to Epidemic That Wasn’t,” (image, above) clearly showed how scientifically inaccurate PCR tests are, featuring many shocking statements from medical experts on the use of these tests, clearly laying out how they result in false positives and lead to dangerous exaggerations and false alarms. [3]
In their 2007 story the New York Times cited a prescient quote from Dr. Elizabeth Talbot, deputy state epidemiologist for the New Hampshire Department of Health and Human Services, who said:
“One of the most troubling aspects of the pseudo-epidemic is that all the decisions seemed so sensible at the time.”
Those who run our public institutions have allowed history to repeat itself. At the head of the line of incompetence and malfeasance is the UN itself. At the media briefing on COVID-19 on March 16, 2020, the WHO Director General Dr Tedros Adhanom Ghebreyesus (photo, below) said:
“We have a simple message for all countries: test, test, test.”
https://i0.wp.com/principia-scientif...pg?w=491&ssl=1
This insanity of testing anyone and everyone, even without symptoms has been an unmitigated global public health scandal and must be stopped. All officials in high places complicit in this crime must be prosecuted.
About the author: John O’Sullivan John is CEO and co-founder (with Dr Tim Ball) of Principia Scientific International (PSI). John is a seasoned science writer and legal analyst who assisted Dr Ball in defeating world leading climate expert, Michael ‘hockey stick’ Mann in the ‘science trial of the century‘. O’Sullivan is credited as the visionary who formed the original ‘Slayers’ group of scientists in 2010 who then collaborated in creating the world’s first full-volume debunk of the greenhouse gas theory plus their new follow-up book.
[1] Kary Mullis : « Le test PCR ne permet pas de savoir si vous êtes malade », vidéo accessible sur YouTube, 9 octobre 2020.
[2] David DeGraw, Torsten Engelbrecht and Konstantin Demeter, https://www.globalresearch.ca/nation...itives/5720271
[3] New York Times,’Faith in Quick Test Leads to Epidemic That Wasn’t,’ Gina Kolota, Published: January 22, 2007
This India woman "Ramola D" has a moderate sized YT (16K subs) & bitchute (368 subs) ch's, & some good interviews & roundtables. The hotter ones are found at her BC ch, recent titles include:
https://static-3.bitchute.com/live/c...fz_640x360.jpghttps://www.bitchute.com/static/v129...lay-button.png
1961:28:39
Jan 21, 2021Celeste Solum Interviews Ramola D: Neuro & Surveillance Tech
Wide-ranging interview with focus on Neurotech/EMF targeting of activists and non-activists by criminals running fusion center operations, and black ops divisions in Military/Intel.
https://static-3.bitchute.com/live/c...t7_640x360.jpghttps://www.bitchute.com/static/v129...lay-button.png
4701:37:41
Jan 19, 2021News Panel 15 | Report 228 | The Current Situation: Dangers of Deception, Fraud & Cover Ops
Thought-provoking conversation on the dangers of the current situation rife with deception on the numbers of cases from high false-positives on the PCR test, unpacking of the vaccine as a genetic engineering bioweapon, dangerous side effects being reported, and information from Pfizer and the MHRA on what really is in the vaccine--synthetic RNA and lipid nanoparticles, among other ingredients. Unexpected dive into the subject of controlled opposition among 5G activists and TI activists, replete with smear operations and harassive bully attacks, the misrepresentation of activists as insane by front-people and governments who use mental health fraud to stop whistleblowing and exposure of govt crime and corruption, and the need for tenacity and truth in all exposure and activism.
https://static-3.bitchute.com/live/c...xy_640x360.jpghttps://www.bitchute.com/static/v129...lay-button.png
1721:51:39
Jan 16, 2021Interviews with Changemakers (18): Peggy Hall, The Healthy American on Masks, Laws, Language, Rights
Impassioned and educative conversation with Peggy Hall, educator, writer, activist, who has founded a new organization The Healthy American to help Americans and people worldwide recognize their rights to health freedom and health choice in an age of government overreach and COVID overkill.
Peggy shares what prompted her to rush into the fray of this national and global conversation as she herself experienced being laid-off from her teaching job in a university, and turned her attention within two weeks of the interminable lockdown in March to the language of the law, the nature of the “Orders” being issued by Health Officers and Governors, and the fraudulent impositions of stricture and “requirement” devoid of statutory legal backing which Governors and Mayors are using to subjugate the American populace. In actuality, the “Orders” are mere Guidance or Guidelines; neither Governors nor Mayors have the jurisdictional authority to impose orders of any kind on individuals
https://static-3.bitchute.com/live/c...N0_640x360.jpghttps://www.bitchute.com/static/v129...lay-button.png
29381:02:43
Jan 16, 2021Newsbreak 105 | Frances Leader on UK MHRA Info:COVID Vaccine Uses Computer-Generated Codes, No Virus
Explosive information from Frances Leader, avid researcher, investigator, and writer, who questioned the UK MHRA and confirmed from them that the RNA genome sequences for the supposed SARS-COV-2 virus being used in the COVID vaccines comes from a string of computer-generated codes, not a real virus. There is no fact no real virus: no virus has been isolated, grown in a petri dish, reinfected anyone, or been spread to anyone--Koch's postulates for defining existence of a virus. What the PCR test is finding is genetic material related to Human Chromosome 8 and found to be common to all living beings; in other words, not a deadly SARS virus but aspects of the living genome shared by all organisms, possibly, Or exosomes from the actions of cells reacting to stresses caused possibly by electromagnetic radiation, specifically 5G--which is still being rolled out worldwide. The importance of knowing there is no specific organic virus that has been isolated and that is being used in the vaccine cannot be underestimated. What it implies is that synthetically-manufactured proteins using gene sequencing technology are being injected into human cells, with the intention of altering the human genome and having no connection whatsoever with a putative virus they are supposed to be protecting from. It also means nobody needs this vaccine--why does anyone need to be injected with computer-generated protein codes formulated synthetically in a lab? Please share this information widely, and look for added commentary on this finding from medical journalists and doctors, moving forward.
https://static-3.bitchute.com/live/c...Nm_640x360.jpghttps://www.bitchute.com/static/v129...lay-button.png
1822:29
Jan 16, 2021Video Snippet--Global Gestapo 12
Video Snippet 1 -- on infiltration and backdoors into society at "authority" levels by secret societies and fraternities.
https://static-3.bitchute.com/live/c...vm_640x360.jpghttps://www.bitchute.com/static/v129...lay-button.png
8771:08:54
Jan 16, 2021Report #227 | Dr. Carrie Madej: Reprogramming of Cells Without Informed Consent--Moratorium Needed
Blockbuster conversation with Dr. Carrie Madej exposing the fact that the Pfizer and Moderna COVID-vaccine is experimental in nature, has not been properly tested in humans, has not been proven safe and effective- (she explains closely how the raw data has been manipulated), and raises many questions regarding dangerous side-effects and adverse events, including death, as well as pointing to the genetic reprogramming of human cells without informed consent provided to those who take it: this is a transhumanizing and nanobot-containing vaccine, but people do not seem to understand this; given the multiple numbers of adverse effects being reported, she calls for an immediate moratorium to halt the rollout and calls for medical professionals to speak out.
An article is forthcoming at The Everyday Concerned Citizen. Please share this video widely for immediate dissemination. Look on Bitchute and Brighteon also shortly for uploads.
https://static-3.bitchute.com/live/c...vZ_640x360.jpghttps://www.bitchute.com/static/v129...lay-button.png
21933:35
Jan 08, 2021NewsBreak 103 | Jan 6, 2021| Note to All Speaking Out Re. Remote-Access Radio Frequency Weaponry
Note to all Doctors, Whistleblowers, Researchers, Activists Speaking Out Today for Medical Freedom, Vaccine Choice, Truth & Human Rights to Be Aware Targeted Remote-Access Radio Frequency Weaponry is in Public Use-- covertly, that is, yet documented; and learn how you can shield from it. This is a report from the front lines from a journalist and writer who has been wrongfully targeted and has experienced heart-hits, head-hits, microwave
"
https://principia-scientific.com/who...has-a-problem/
WHO Finally Admits COVID19 PCR Test Has a ‘Problem’
Published on December 17, 2020"
Just wanted to remind everyone that Trump got the USA out of participation with the WHO in May of 2020.
https://www.cnn.com/2020/05/29/polit...ion/index.html
He said China controls the WHO and was donating small dollars versus mega US dollars donated to WHO. This is one of the many good actions Trump accomplished, the foremost of which, for me anyway, is having kept the USA out of another war for the globalist banksters.
(The nature of CCP's connection to this "worldwide pandemic" is not appropriate to discuss in this thread. I may start a thread in the Religion / Philosophy section of this forum because that topic is fraught with deliberate voids in our fund of knowledge.)
HARRY VOX interviews Klaus Schwab (spoof, 11m :D)
THE GREAT RESET EXPLAINED
NSFW - potty mouth :o
January 6:
Hank Aaron, 86, receives COVID-19 vaccine and hopes to inspire other Black Americans to do the same
https://www.cbssports.com/mlb/news/h...o-do-the-same/
January 22:
Hank Aaron, baseball legend, remembered after death
https://www.cbsnews.com/video/hank-a...d-after-death/
GET YOUR VACCINES GUYS!
Tucker Carlson is particularly dyspepsic in his prissy smirky fake commentary. The presentation is full of fake mixed messages. First they tell you how well Florida has handled the virus issue and how many New Yorkers are moving to Florida. Then they tell you one of the ways Florida governor is professionally handling the virus distribution problems is to put all 4.3 million age 65 and over people at the front of the line to receive the vaccine. How murderous, genocidal and evil!!!!
Fox News loves to focus on petty play-acting fake fights between sleazy politicians and presstitutee reporters fake disputes. Fox News is nothing more than a low-grade soap opera production.
Truth about the vaccine and handling the fake pandemic fake virus problem is missing in action.
https://www.youtube.com/watch?v=h5JYIXowrEc
https://www.youtube.com/watch?v=h5JYIXowrEc
8:36 video runtime
(I had to stop at about 3:46 as my nausea tolerance level collpased.)
Ron DeSantis responds to viral clip of him being 'attacked' by CNN reporter
2,173,844 views
•Premiered Jan 5, 2021
44K
1.7K
Share
Save
Fox News
6.79M subscribers
Angry CNN activist takes on Florida Gov. Ron DeSantis on vaccine rollout. Fox Tampa Bar Reporter Craig Patrick and Gov. Ron DeSantis join 'Tucker Carlson Tonight' to discus bias media coverage. #FoxNews #Tucker
Quote:
Originally Posted by Shami-Amourae
(((Larry King))) also croaked yesterday or this morning sometime - not sure what his "VAXXED!" story was, but he was 87yo, & I *thought* a news story was floated in the recent couple months re his getting the MuhRONA on him.
So many fake stories re celeb-types getting the RONA, as pure propaganda to keep the hoax in the (tabloid...) headlines in addition to the MSM fake news, it's impossible to decipher what's true & fake anymore. :(??
Quote:
So many fake stories re celeb-types getting the RONA, as pure propaganda to keep the hoax in the (tabloid...) headlines in addition to the MSM fake news, it's impossible to decipher what's true & fake anymore. http://gold-silver.us/forum/images/s...300%20(24).gif
Absolutely. We’re overwhelmed with bs